Incidental Mutation 'R8373:Cul1'
List |< first << previous [record 9 of 38] next >> last >|
ID646538
Institutional Source Beutler Lab
Gene Symbol Cul1
Ensembl Gene ENSMUSG00000029686
Gene Namecullin 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8373 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location47453398-47526139 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 47515063 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 426 (C426S)
Ref Sequence ENSEMBL: ENSMUSP00000031697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031697] [ENSMUST00000146200]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031697
AA Change: C426S

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031697
Gene: ENSMUSG00000029686
AA Change: C426S

DomainStartEndE-ValueType
SCOP:d1ldja2 17 410 1e-174 SMART
CULLIN 447 594 3.69e-81 SMART
low complexity region 638 651 N/A INTRINSIC
Cullin_Nedd8 703 770 6.19e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000146200
AA Change: C426S

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122702
Gene: ENSMUSG00000029686
AA Change: C426S

DomainStartEndE-ValueType
SCOP:d1ldja2 17 410 1e-176 SMART
CULLIN 447 594 3.69e-81 SMART
low complexity region 638 651 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations accumulate cyclin E1 and exhibit arrested development and lethality around embryonic day 6.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik T G 6: 41,031,688 T231P possibly damaging Het
Adgrg6 T C 10: 14,467,334 T290A probably benign Het
Aff4 C T 11: 53,400,267 Q685* probably null Het
Ankmy1 A G 1: 92,896,094 M150T probably damaging Het
Armc1 T C 3: 19,149,567 Y65C probably damaging Het
Armc8 A G 9: 99,527,099 V222A probably benign Het
Bcar1 A T 8: 111,715,738 Y228* probably null Het
Cct2 T C 10: 117,060,824 D158G possibly damaging Het
Deup1 G T 9: 15,592,375 L297M possibly damaging Het
Dpp10 A G 1: 123,854,229 S74P possibly damaging Het
Epha4 A G 1: 77,507,079 Y98H possibly damaging Het
Epn3 T G 11: 94,492,936 D296A probably damaging Het
Eri2 A C 7: 119,772,597 I252S probably benign Het
Gm14025 T A 2: 129,038,171 I612F Het
Gp9 C T 6: 87,779,012 T3I probably benign Het
H2-Q5 T A 17: 35,394,456 V55E Het
Kif3c G T 12: 3,366,089 V37L probably benign Het
Lct A T 1: 128,303,840 N757K probably damaging Het
Lhx8 A C 3: 154,324,658 N112K probably damaging Het
Loxl3 T A 6: 83,048,891 S373R possibly damaging Het
Mettl4 G A 17: 94,733,649 T359I probably damaging Het
Mpp7 A G 18: 7,444,096 S109P probably damaging Het
Nckap5 A G 1: 126,026,295 V840A probably benign Het
Ncoa4 T A 14: 32,176,936 L571Q probably damaging Het
Olfr453 T C 6: 42,744,346 F103S probably damaging Het
Olfr46 A T 7: 140,610,295 Y35F possibly damaging Het
Phgdh G A 3: 98,321,245 T204I probably damaging Het
Pla2g4d C T 2: 120,277,499 V310M probably null Het
Psmd12 C T 11: 107,497,624 P421L probably damaging Het
Ptch1 A G 13: 63,541,168 Y432H probably damaging Het
Rapgef1 G A 2: 29,710,231 G655S probably damaging Het
Rilpl2 C A 5: 124,478,034 A18S probably damaging Het
Srsf7 T C 17: 80,205,386 R88G probably benign Het
St6galnac1 T C 11: 116,769,233 K85E possibly damaging Het
Trip12 A T 1: 84,795,767 S49R probably damaging Het
Wdr48 A G 9: 119,905,494 T160A probably damaging Het
Zfp704 G A 3: 9,609,442 T93M unknown Het
Other mutations in Cul1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Cul1 APN 6 47509044 missense probably benign
IGL02410:Cul1 APN 6 47485014 missense probably damaging 1.00
IGL02458:Cul1 APN 6 47525608 missense possibly damaging 0.91
IGL02490:Cul1 APN 6 47514886 missense probably damaging 0.98
IGL03065:Cul1 APN 6 47495081 missense probably damaging 1.00
IGL03387:Cul1 APN 6 47501209 missense probably damaging 0.96
IGL02837:Cul1 UTSW 6 47523205 missense probably benign 0.01
R0064:Cul1 UTSW 6 47502415 splice site probably benign
R0064:Cul1 UTSW 6 47502415 splice site probably benign
R0436:Cul1 UTSW 6 47523773 missense probably benign 0.16
R0746:Cul1 UTSW 6 47518288 splice site probably null
R1103:Cul1 UTSW 6 47517177 missense probably benign 0.03
R1471:Cul1 UTSW 6 47514886 missense probably damaging 0.98
R1746:Cul1 UTSW 6 47508245 missense probably damaging 0.98
R1852:Cul1 UTSW 6 47520830 missense probably damaging 0.99
R1858:Cul1 UTSW 6 47525524 splice site probably null
R1937:Cul1 UTSW 6 47508355 missense probably benign 0.19
R1964:Cul1 UTSW 6 47502571 missense probably damaging 0.98
R2985:Cul1 UTSW 6 47502507 missense probably damaging 1.00
R4452:Cul1 UTSW 6 47508989 nonsense probably null
R4653:Cul1 UTSW 6 47484963 missense probably damaging 1.00
R4860:Cul1 UTSW 6 47517146 missense probably benign 0.38
R4860:Cul1 UTSW 6 47517191 missense probably damaging 0.99
R4860:Cul1 UTSW 6 47517146 missense probably benign 0.38
R4860:Cul1 UTSW 6 47517191 missense probably damaging 0.99
R5141:Cul1 UTSW 6 47520839 missense probably benign 0.04
R5328:Cul1 UTSW 6 47508317 missense probably damaging 0.99
R5399:Cul1 UTSW 6 47485084 splice site probably null
R5593:Cul1 UTSW 6 47485086 nonsense probably null
R5593:Cul1 UTSW 6 47514991 missense probably damaging 0.99
R5616:Cul1 UTSW 6 47523788 missense probably damaging 1.00
R5855:Cul1 UTSW 6 47523213 missense probably benign 0.00
R6382:Cul1 UTSW 6 47502439 missense probably damaging 1.00
R6670:Cul1 UTSW 6 47517134 missense probably damaging 1.00
R6964:Cul1 UTSW 6 47516509 missense probably benign 0.01
R8146:Cul1 UTSW 6 47495093 missense possibly damaging 0.50
R8842:Cul1 UTSW 6 47515076 missense probably damaging 1.00
RF001:Cul1 UTSW 6 47524581 missense possibly damaging 0.50
RF055:Cul1 UTSW 6 47517133 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAACGATGCTGGCTTCG -3'
(R):5'- CAGCTCTGTCAAATGTAGACCAAC -3'

Sequencing Primer
(F):5'- CGTAGCTGCTCTTGATAAGGTAAG -3'
(R):5'- GTAGTATTCAGTTTTCTCCGACTG -3'
Posted On2020-09-02