Incidental Mutation 'R8373:Gp9'
ID646540
Institutional Source Beutler Lab
Gene Symbol Gp9
Ensembl Gene ENSMUSG00000030054
Gene Nameglycoprotein 9 (platelet)
SynonymsGPIX, Cd42
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8373 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location87778072-87779768 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87779012 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 3 (T3I)
Ref Sequence ENSEMBL: ENSMUSP00000032133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032133]
Predicted Effect probably benign
Transcript: ENSMUST00000032133
AA Change: T3I

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000032133
Gene: ENSMUSG00000030054
AA Change: T3I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LRRNT 19 55 2.84e-9 SMART
LRRCT 85 136 4.22e-9 SMART
transmembrane domain 147 169 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a small membrane glycoprotein found on the surface of human platelets. It forms a 1-to-1 noncovalent complex with glycoprotein Ib, a platelet surface membrane glycoprotein complex that functions as a receptor for von Willebrand factor. The complete receptor complex includes noncovalent association of the alpha and beta subunits with the protein encoded by this gene and platelet glycoprotein V. Defects in this gene are a cause of Bernard-Soulier syndrome, also known as giant platelet disease. These patients have unusually large platelets and have a clinical bleeding tendency. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik T G 6: 41,031,688 T231P possibly damaging Het
Adgrg6 T C 10: 14,467,334 T290A probably benign Het
Aff4 C T 11: 53,400,267 Q685* probably null Het
Ankmy1 A G 1: 92,896,094 M150T probably damaging Het
Armc1 T C 3: 19,149,567 Y65C probably damaging Het
Armc8 A G 9: 99,527,099 V222A probably benign Het
Bcar1 A T 8: 111,715,738 Y228* probably null Het
Cct2 T C 10: 117,060,824 D158G possibly damaging Het
Cul1 T A 6: 47,515,063 C426S possibly damaging Het
Deup1 G T 9: 15,592,375 L297M possibly damaging Het
Dpp10 A G 1: 123,854,229 S74P possibly damaging Het
Epha4 A G 1: 77,507,079 Y98H possibly damaging Het
Epn3 T G 11: 94,492,936 D296A probably damaging Het
Eri2 A C 7: 119,772,597 I252S probably benign Het
Gm14025 T A 2: 129,038,171 I612F Het
H2-Q5 T A 17: 35,394,456 V55E Het
Kif3c G T 12: 3,366,089 V37L probably benign Het
Lct A T 1: 128,303,840 N757K probably damaging Het
Lhx8 A C 3: 154,324,658 N112K probably damaging Het
Loxl3 T A 6: 83,048,891 S373R possibly damaging Het
Mettl4 G A 17: 94,733,649 T359I probably damaging Het
Mpp7 A G 18: 7,444,096 S109P probably damaging Het
Nckap5 A G 1: 126,026,295 V840A probably benign Het
Ncoa4 T A 14: 32,176,936 L571Q probably damaging Het
Olfr453 T C 6: 42,744,346 F103S probably damaging Het
Olfr46 A T 7: 140,610,295 Y35F possibly damaging Het
Phgdh G A 3: 98,321,245 T204I probably damaging Het
Pla2g4d C T 2: 120,277,499 V310M probably null Het
Psmd12 C T 11: 107,497,624 P421L probably damaging Het
Ptch1 A G 13: 63,541,168 Y432H probably damaging Het
Rapgef1 G A 2: 29,710,231 G655S probably damaging Het
Rilpl2 C A 5: 124,478,034 A18S probably damaging Het
Srsf7 T C 17: 80,205,386 R88G probably benign Het
St6galnac1 T C 11: 116,769,233 K85E possibly damaging Het
Trip12 A T 1: 84,795,767 S49R probably damaging Het
Wdr48 A G 9: 119,905,494 T160A probably damaging Het
Zfp704 G A 3: 9,609,442 T93M unknown Het
Other mutations in Gp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02900:Gp9 APN 6 87779433 missense probably damaging 1.00
R2173:Gp9 UTSW 6 87779053 missense probably benign 0.05
R3778:Gp9 UTSW 6 87779005 start codon destroyed probably benign 0.00
R3847:Gp9 UTSW 6 87779151 missense probably benign 0.08
R3849:Gp9 UTSW 6 87779151 missense probably benign 0.08
R4936:Gp9 UTSW 6 87779247 missense probably benign 0.02
R8073:Gp9 UTSW 6 87779354 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGACTGGAGTCCCTTAGCAG -3'
(R):5'- CTATTGTTGGCCAGCAGGAG -3'

Sequencing Primer
(F):5'- GTTTCCCTATCTGAGCAGAGGC -3'
(R):5'- CAGGAGCTGGCGAGTGTG -3'
Posted On2020-09-02