Incidental Mutation 'R8373:Bcar1'
ID646543
Institutional Source Beutler Lab
Gene Symbol Bcar1
Ensembl Gene ENSMUSG00000031955
Gene Namebreast cancer anti-estrogen resistance 1
Synonymsp130Cas, Cas, Crkas
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8373 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location111710474-111743809 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 111715738 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 228 (Y228*)
Ref Sequence ENSEMBL: ENSMUSP00000129584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166232] [ENSMUST00000212349]
Predicted Effect probably null
Transcript: ENSMUST00000166232
AA Change: Y228*
SMART Domains Protein: ENSMUSP00000129584
Gene: ENSMUSG00000031955
AA Change: Y228*

DomainStartEndE-ValueType
SH3 6 64 3e-20 SMART
low complexity region 71 92 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 353 388 N/A INTRINSIC
low complexity region 430 448 N/A INTRINSIC
Pfam:Serine_rich 458 612 9e-49 PFAM
Pfam:DUF3513 658 868 2.1e-78 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000212349
AA Change: Y228*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] BCAR1, or CAS, is an Src (MIM 190090) family kinase substrate involved in various cellular events, including migration, survival, transformation, and invasion (Sawada et al., 2006 [PubMed 17129785]).[supplied by OMIM, May 2009]
PHENOTYPE: Homozygous null embryos exhibit growth retardation and embryonic lethality, following disruption of cardiac myofibrils, increased vasodilation, and systemic congestion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik T G 6: 41,031,688 T231P possibly damaging Het
Adgrg6 T C 10: 14,467,334 T290A probably benign Het
Aff4 C T 11: 53,400,267 Q685* probably null Het
Ankmy1 A G 1: 92,896,094 M150T probably damaging Het
Armc1 T C 3: 19,149,567 Y65C probably damaging Het
Armc8 A G 9: 99,527,099 V222A probably benign Het
Cct2 T C 10: 117,060,824 D158G possibly damaging Het
Cul1 T A 6: 47,515,063 C426S possibly damaging Het
Deup1 G T 9: 15,592,375 L297M possibly damaging Het
Dpp10 A G 1: 123,854,229 S74P possibly damaging Het
Epha4 A G 1: 77,507,079 Y98H possibly damaging Het
Epn3 T G 11: 94,492,936 D296A probably damaging Het
Eri2 A C 7: 119,772,597 I252S probably benign Het
Gm14025 T A 2: 129,038,171 I612F Het
Gp9 C T 6: 87,779,012 T3I probably benign Het
H2-Q5 T A 17: 35,394,456 V55E Het
Kif3c G T 12: 3,366,089 V37L probably benign Het
Lct A T 1: 128,303,840 N757K probably damaging Het
Lhx8 A C 3: 154,324,658 N112K probably damaging Het
Loxl3 T A 6: 83,048,891 S373R possibly damaging Het
Mettl4 G A 17: 94,733,649 T359I probably damaging Het
Mpp7 A G 18: 7,444,096 S109P probably damaging Het
Nckap5 A G 1: 126,026,295 V840A probably benign Het
Ncoa4 T A 14: 32,176,936 L571Q probably damaging Het
Olfr453 T C 6: 42,744,346 F103S probably damaging Het
Olfr46 A T 7: 140,610,295 Y35F possibly damaging Het
Phgdh G A 3: 98,321,245 T204I probably damaging Het
Pla2g4d C T 2: 120,277,499 V310M probably null Het
Psmd12 C T 11: 107,497,624 P421L probably damaging Het
Ptch1 A G 13: 63,541,168 Y432H probably damaging Het
Rapgef1 G A 2: 29,710,231 G655S probably damaging Het
Rilpl2 C A 5: 124,478,034 A18S probably damaging Het
Srsf7 T C 17: 80,205,386 R88G probably benign Het
St6galnac1 T C 11: 116,769,233 K85E possibly damaging Het
Trip12 A T 1: 84,795,767 S49R probably damaging Het
Wdr48 A G 9: 119,905,494 T160A probably damaging Het
Zfp704 G A 3: 9,609,442 T93M unknown Het
Other mutations in Bcar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02220:Bcar1 APN 8 111711207 missense possibly damaging 0.82
IGL02852:Bcar1 APN 8 111715347 nonsense probably null
R1914:Bcar1 UTSW 8 111715398 missense probably damaging 0.98
R1915:Bcar1 UTSW 8 111715398 missense probably damaging 0.98
R4130:Bcar1 UTSW 8 111714165 missense possibly damaging 0.47
R4249:Bcar1 UTSW 8 111720893 missense probably benign
R4437:Bcar1 UTSW 8 111715389 missense probably damaging 1.00
R4794:Bcar1 UTSW 8 111720920 nonsense probably null
R4937:Bcar1 UTSW 8 111721037 missense probably damaging 0.98
R5402:Bcar1 UTSW 8 111714330 missense probably damaging 1.00
R5951:Bcar1 UTSW 8 111713400 missense probably benign 0.02
R6443:Bcar1 UTSW 8 111715338 missense probably damaging 1.00
R7595:Bcar1 UTSW 8 111720993 missense probably benign 0.01
R8313:Bcar1 UTSW 8 111713638 missense probably benign 0.01
RF025:Bcar1 UTSW 8 111714177 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TAGGCTGAGAAAATGCAGCTCC -3'
(R):5'- GCATTTCACTGCAGAAAAGGAG -3'

Sequencing Primer
(F):5'- CTGAGAAAATGCAGCTCCCAGAG -3'
(R):5'- TTCACTGCAGAAAAGGAGCTCCC -3'
Posted On2020-09-02