Incidental Mutation 'R8373:Armc8'
ID 646545
Institutional Source Beutler Lab
Gene Symbol Armc8
Ensembl Gene ENSMUSG00000032468
Gene Name armadillo repeat containing 8
Synonyms 1200015K23Rik, Gid5, HSPC056
MMRRC Submission 067741-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.683) question?
Stock # R8373 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 99360425-99450952 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 99409152 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 222 (V222A)
Ref Sequence ENSEMBL: ENSMUSP00000035043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035043] [ENSMUST00000185524] [ENSMUST00000186049]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000035043
AA Change: V222A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000035043
Gene: ENSMUSG00000032468
AA Change: V222A

DomainStartEndE-ValueType
ARM 50 92 1.75e0 SMART
ARM 94 134 5.34e0 SMART
ARM 177 217 2.04e1 SMART
ARM 372 413 3.58e1 SMART
Blast:ARM 414 455 7e-17 BLAST
ARM 457 497 3.81e-1 SMART
ARM 500 540 5.43e1 SMART
Blast:ARM 542 585 1e-20 BLAST
Blast:ARM 633 673 1e-16 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000185524
AA Change: V222A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139973
Gene: ENSMUSG00000032468
AA Change: V222A

DomainStartEndE-ValueType
ARM 50 92 1.75e0 SMART
ARM 94 134 5.34e0 SMART
Blast:ARM 138 176 1e-5 BLAST
ARM 177 217 2.04e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186049
AA Change: V180A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140426
Gene: ENSMUSG00000032468
AA Change: V180A

DomainStartEndE-ValueType
ARM 8 50 8.5e-3 SMART
ARM 52 92 2.6e-2 SMART
Blast:ARM 96 134 7e-6 BLAST
ARM 135 175 9.8e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 T C 10: 14,343,078 (GRCm39) T290A probably benign Het
Aff4 C T 11: 53,291,094 (GRCm39) Q685* probably null Het
Ankmy1 A G 1: 92,823,816 (GRCm39) M150T probably damaging Het
Armc1 T C 3: 19,203,731 (GRCm39) Y65C probably damaging Het
Bcar1 A T 8: 112,442,370 (GRCm39) Y228* probably null Het
Cct2 T C 10: 116,896,729 (GRCm39) D158G possibly damaging Het
Cul1 T A 6: 47,491,997 (GRCm39) C426S possibly damaging Het
Deup1 G T 9: 15,503,671 (GRCm39) L297M possibly damaging Het
Dpp10 A G 1: 123,781,958 (GRCm39) S74P possibly damaging Het
Epha4 A G 1: 77,483,716 (GRCm39) Y98H possibly damaging Het
Epn3 T G 11: 94,383,762 (GRCm39) D296A probably damaging Het
Eri2 A C 7: 119,371,820 (GRCm39) I252S probably benign Het
Gp9 C T 6: 87,755,994 (GRCm39) T3I probably benign Het
H2-Q5 T A 17: 35,613,432 (GRCm39) V55E Het
Kif3c G T 12: 3,416,089 (GRCm39) V37L probably benign Het
Lct A T 1: 128,231,577 (GRCm39) N757K probably damaging Het
Lhx8 A C 3: 154,030,295 (GRCm39) N112K probably damaging Het
Loxl3 T A 6: 83,025,872 (GRCm39) S373R possibly damaging Het
Mettl4 G A 17: 95,041,077 (GRCm39) T359I probably damaging Het
Mpp7 A G 18: 7,444,096 (GRCm39) S109P probably damaging Het
Nckap5 A G 1: 125,954,032 (GRCm39) V840A probably benign Het
Ncoa4 T A 14: 31,898,893 (GRCm39) L571Q probably damaging Het
Or13a18 A T 7: 140,190,208 (GRCm39) Y35F possibly damaging Het
Or2f1 T C 6: 42,721,280 (GRCm39) F103S probably damaging Het
Phgdh G A 3: 98,228,561 (GRCm39) T204I probably damaging Het
Pla2g4d C T 2: 120,107,980 (GRCm39) V310M probably null Het
Prss3b T G 6: 41,008,622 (GRCm39) T231P possibly damaging Het
Psmd12 C T 11: 107,388,450 (GRCm39) P421L probably damaging Het
Ptch1 A G 13: 63,688,982 (GRCm39) Y432H probably damaging Het
Rapgef1 G A 2: 29,600,243 (GRCm39) G655S probably damaging Het
Rilpl2 C A 5: 124,616,097 (GRCm39) A18S probably damaging Het
Srsf7 T C 17: 80,512,815 (GRCm39) R88G probably benign Het
St6galnac1 T C 11: 116,660,059 (GRCm39) K85E possibly damaging Het
Trip12 A T 1: 84,773,488 (GRCm39) S49R probably damaging Het
Vinac1 T A 2: 128,880,091 (GRCm39) I612F Het
Wdr48 A G 9: 119,734,560 (GRCm39) T160A probably damaging Het
Zfp704 G A 3: 9,674,502 (GRCm39) T93M unknown Het
Other mutations in Armc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Armc8 APN 9 99,387,787 (GRCm39) critical splice acceptor site probably null
IGL00951:Armc8 APN 9 99,387,757 (GRCm39) missense probably benign 0.00
IGL01776:Armc8 APN 9 99,408,936 (GRCm39) splice site probably benign
IGL02215:Armc8 APN 9 99,366,031 (GRCm39) missense possibly damaging 0.92
IGL02244:Armc8 APN 9 99,365,227 (GRCm39) missense probably benign 0.10
IGL02610:Armc8 APN 9 99,409,122 (GRCm39) splice site probably benign
IGL02612:Armc8 APN 9 99,409,122 (GRCm39) splice site probably benign
IGL02615:Armc8 APN 9 99,409,122 (GRCm39) splice site probably benign
IGL02619:Armc8 APN 9 99,409,122 (GRCm39) splice site probably benign
IGL02621:Armc8 APN 9 99,409,122 (GRCm39) splice site probably benign
IGL02622:Armc8 APN 9 99,409,122 (GRCm39) splice site probably benign
IGL02623:Armc8 APN 9 99,409,122 (GRCm39) splice site probably benign
IGL02624:Armc8 APN 9 99,409,122 (GRCm39) splice site probably benign
Scrambler UTSW 9 99,378,202 (GRCm39) critical splice donor site probably null
warthog UTSW 9 99,402,538 (GRCm39) missense probably benign 0.02
D4043:Armc8 UTSW 9 99,366,029 (GRCm39) missense probably benign 0.13
R0321:Armc8 UTSW 9 99,415,230 (GRCm39) missense probably damaging 0.99
R0498:Armc8 UTSW 9 99,379,345 (GRCm39) missense probably damaging 1.00
R0646:Armc8 UTSW 9 99,387,741 (GRCm39) missense probably damaging 1.00
R0658:Armc8 UTSW 9 99,418,211 (GRCm39) splice site probably benign
R1061:Armc8 UTSW 9 99,419,784 (GRCm39) missense probably damaging 1.00
R1406:Armc8 UTSW 9 99,405,301 (GRCm39) missense probably benign 0.37
R1406:Armc8 UTSW 9 99,405,301 (GRCm39) missense probably benign 0.37
R1429:Armc8 UTSW 9 99,418,260 (GRCm39) missense possibly damaging 0.67
R1432:Armc8 UTSW 9 99,405,185 (GRCm39) splice site probably benign
R1538:Armc8 UTSW 9 99,387,343 (GRCm39) missense probably damaging 0.96
R1606:Armc8 UTSW 9 99,419,782 (GRCm39) missense probably damaging 0.98
R1817:Armc8 UTSW 9 99,418,312 (GRCm39) missense possibly damaging 0.67
R1866:Armc8 UTSW 9 99,418,333 (GRCm39) missense probably benign
R2015:Armc8 UTSW 9 99,365,158 (GRCm39) nonsense probably null
R2143:Armc8 UTSW 9 99,387,361 (GRCm39) missense probably damaging 0.99
R2251:Armc8 UTSW 9 99,384,653 (GRCm39) critical splice acceptor site probably null
R2842:Armc8 UTSW 9 99,387,734 (GRCm39) missense probably benign
R3010:Armc8 UTSW 9 99,369,966 (GRCm39) missense probably benign 0.06
R3709:Armc8 UTSW 9 99,402,550 (GRCm39) missense probably damaging 1.00
R4440:Armc8 UTSW 9 99,366,087 (GRCm39) missense probably benign 0.37
R4865:Armc8 UTSW 9 99,408,942 (GRCm39) critical splice donor site probably null
R5492:Armc8 UTSW 9 99,409,184 (GRCm39) nonsense probably null
R5606:Armc8 UTSW 9 99,418,315 (GRCm39) missense probably benign 0.23
R5639:Armc8 UTSW 9 99,378,202 (GRCm39) critical splice donor site probably null
R5693:Armc8 UTSW 9 99,378,202 (GRCm39) critical splice donor site probably null
R5694:Armc8 UTSW 9 99,378,202 (GRCm39) critical splice donor site probably null
R5698:Armc8 UTSW 9 99,417,873 (GRCm39) missense probably benign 0.12
R5700:Armc8 UTSW 9 99,378,202 (GRCm39) critical splice donor site probably null
R5701:Armc8 UTSW 9 99,378,202 (GRCm39) critical splice donor site probably null
R5735:Armc8 UTSW 9 99,379,447 (GRCm39) critical splice acceptor site probably null
R6314:Armc8 UTSW 9 99,417,937 (GRCm39) missense probably benign 0.28
R7034:Armc8 UTSW 9 99,366,018 (GRCm39) critical splice donor site probably null
R7036:Armc8 UTSW 9 99,366,018 (GRCm39) critical splice donor site probably null
R7393:Armc8 UTSW 9 99,366,052 (GRCm39) missense possibly damaging 0.47
R7395:Armc8 UTSW 9 99,415,185 (GRCm39) missense probably damaging 0.99
R7937:Armc8 UTSW 9 99,418,272 (GRCm39) missense probably damaging 0.98
R8130:Armc8 UTSW 9 99,433,600 (GRCm39) missense probably benign 0.02
R8734:Armc8 UTSW 9 99,402,538 (GRCm39) missense probably benign 0.02
R9098:Armc8 UTSW 9 99,387,362 (GRCm39) nonsense probably null
R9255:Armc8 UTSW 9 99,379,441 (GRCm39) missense possibly damaging 0.95
R9358:Armc8 UTSW 9 99,450,653 (GRCm39) critical splice donor site probably null
R9463:Armc8 UTSW 9 99,378,203 (GRCm39) critical splice donor site probably null
Z1177:Armc8 UTSW 9 99,379,439 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCTGCATCTCAATAGGCTTATCC -3'
(R):5'- CAAGTGGCCTGTTTGAGCTG -3'

Sequencing Primer
(F):5'- AATAGGCTTATCCCTCTGTAACATC -3'
(R):5'- GCCTCTTGCCTGTTCATAATAAGTAG -3'
Posted On 2020-09-02