Incidental Mutation 'R8373:Psmd12'
List |< first << previous [record 30 of 38] next >> last >|
ID646551
Institutional Source Beutler Lab
Gene Symbol Psmd12
Ensembl Gene ENSMUSG00000020720
Gene Nameproteasome (prosome, macropain) 26S subunit, non-ATPase, 12
Synonyms1500002F15Rik, P55
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R8373 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location107479484-107504362 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 107497624 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 421 (P421L)
Ref Sequence ENSEMBL: ENSMUSP00000021063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021063] [ENSMUST00000106750] [ENSMUST00000106752]
Predicted Effect probably damaging
Transcript: ENSMUST00000021063
AA Change: P421L

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021063
Gene: ENSMUSG00000020720
AA Change: P421L

DomainStartEndE-ValueType
PINT 349 435 3.24e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106750
AA Change: P401L

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102361
Gene: ENSMUSG00000020720
AA Change: P401L

DomainStartEndE-ValueType
PINT 329 415 3.24e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106752
SMART Domains Protein: ENSMUSP00000102363
Gene: ENSMUSG00000020720

DomainStartEndE-ValueType
Pfam:PCI 300 398 1.3e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. A pseudogene has been identified on chromosome 3. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik T G 6: 41,031,688 T231P possibly damaging Het
Adgrg6 T C 10: 14,467,334 T290A probably benign Het
Aff4 C T 11: 53,400,267 Q685* probably null Het
Ankmy1 A G 1: 92,896,094 M150T probably damaging Het
Armc1 T C 3: 19,149,567 Y65C probably damaging Het
Armc8 A G 9: 99,527,099 V222A probably benign Het
Bcar1 A T 8: 111,715,738 Y228* probably null Het
Cct2 T C 10: 117,060,824 D158G possibly damaging Het
Cul1 T A 6: 47,515,063 C426S possibly damaging Het
Deup1 G T 9: 15,592,375 L297M possibly damaging Het
Dpp10 A G 1: 123,854,229 S74P possibly damaging Het
Epha4 A G 1: 77,507,079 Y98H possibly damaging Het
Epn3 T G 11: 94,492,936 D296A probably damaging Het
Eri2 A C 7: 119,772,597 I252S probably benign Het
Gm14025 T A 2: 129,038,171 I612F Het
Gp9 C T 6: 87,779,012 T3I probably benign Het
H2-Q5 T A 17: 35,394,456 V55E Het
Kif3c G T 12: 3,366,089 V37L probably benign Het
Lct A T 1: 128,303,840 N757K probably damaging Het
Lhx8 A C 3: 154,324,658 N112K probably damaging Het
Loxl3 T A 6: 83,048,891 S373R possibly damaging Het
Mettl4 G A 17: 94,733,649 T359I probably damaging Het
Mpp7 A G 18: 7,444,096 S109P probably damaging Het
Nckap5 A G 1: 126,026,295 V840A probably benign Het
Ncoa4 T A 14: 32,176,936 L571Q probably damaging Het
Olfr453 T C 6: 42,744,346 F103S probably damaging Het
Olfr46 A T 7: 140,610,295 Y35F possibly damaging Het
Phgdh G A 3: 98,321,245 T204I probably damaging Het
Pla2g4d C T 2: 120,277,499 V310M probably null Het
Ptch1 A G 13: 63,541,168 Y432H probably damaging Het
Rapgef1 G A 2: 29,710,231 G655S probably damaging Het
Rilpl2 C A 5: 124,478,034 A18S probably damaging Het
Srsf7 T C 17: 80,205,386 R88G probably benign Het
St6galnac1 T C 11: 116,769,233 K85E possibly damaging Het
Trip12 A T 1: 84,795,767 S49R probably damaging Het
Wdr48 A G 9: 119,905,494 T160A probably damaging Het
Zfp704 G A 3: 9,609,442 T93M unknown Het
Other mutations in Psmd12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03002:Psmd12 APN 11 107485781 missense probably benign 0.00
R0384:Psmd12 UTSW 11 107485721 missense probably benign 0.00
R1457:Psmd12 UTSW 11 107479646 missense probably damaging 1.00
R1661:Psmd12 UTSW 11 107491906 missense probably damaging 1.00
R2443:Psmd12 UTSW 11 107495737 missense probably damaging 1.00
R3806:Psmd12 UTSW 11 107495765 missense probably benign 0.03
R3807:Psmd12 UTSW 11 107495765 missense probably benign 0.03
R3840:Psmd12 UTSW 11 107485572 missense probably benign 0.02
R4212:Psmd12 UTSW 11 107485759 missense probably damaging 1.00
R4718:Psmd12 UTSW 11 107486433 missense probably benign 0.15
R5182:Psmd12 UTSW 11 107479659 missense probably damaging 1.00
R5586:Psmd12 UTSW 11 107486475 missense probably benign 0.35
R6171:Psmd12 UTSW 11 107491907 missense probably damaging 0.96
R6444:Psmd12 UTSW 11 107486454 missense possibly damaging 0.55
R6527:Psmd12 UTSW 11 107488968 missense probably damaging 0.96
R7276:Psmd12 UTSW 11 107503645 nonsense probably null
R7466:Psmd12 UTSW 11 107492057 missense probably benign 0.03
R7751:Psmd12 UTSW 11 107479613 missense possibly damaging 0.68
R7779:Psmd12 UTSW 11 107497579 missense probably benign 0.01
Z1177:Psmd12 UTSW 11 107485557 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- CAGTGCTCTCAGCTTGTGTG -3'
(R):5'- GCTGAGACACAAACCTTTCTGTC -3'

Sequencing Primer
(F):5'- CTCTCAGCTTGTGTGTTCATG -3'
(R):5'- GAGGGGGCTTAAACACATTTACTATC -3'
Posted On2020-09-02