Incidental Mutation 'R8373:Kif3c'
ID 646553
Institutional Source Beutler Lab
Gene Symbol Kif3c
Ensembl Gene ENSMUSG00000020668
Gene Name kinesin family member 3C
Synonyms N-4 kinesin
MMRRC Submission 067741-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.355) question?
Stock # R8373 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 3415132-3456494 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 3416089 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 37 (V37L)
Ref Sequence ENSEMBL: ENSMUSP00000020999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020999] [ENSMUST00000220210]
AlphaFold O35066
Predicted Effect probably benign
Transcript: ENSMUST00000020999
AA Change: V37L

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000020999
Gene: ENSMUSG00000020668
AA Change: V37L

DomainStartEndE-ValueType
KISc 8 375 5.43e-171 SMART
low complexity region 404 421 N/A INTRINSIC
low complexity region 435 443 N/A INTRINSIC
low complexity region 486 505 N/A INTRINSIC
Blast:KISc 508 579 3e-8 BLAST
low complexity region 580 602 N/A INTRINSIC
Blast:KISc 603 666 1e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000220210
AA Change: V37L

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 T C 10: 14,343,078 (GRCm39) T290A probably benign Het
Aff4 C T 11: 53,291,094 (GRCm39) Q685* probably null Het
Ankmy1 A G 1: 92,823,816 (GRCm39) M150T probably damaging Het
Armc1 T C 3: 19,203,731 (GRCm39) Y65C probably damaging Het
Armc8 A G 9: 99,409,152 (GRCm39) V222A probably benign Het
Bcar1 A T 8: 112,442,370 (GRCm39) Y228* probably null Het
Cct2 T C 10: 116,896,729 (GRCm39) D158G possibly damaging Het
Cul1 T A 6: 47,491,997 (GRCm39) C426S possibly damaging Het
Deup1 G T 9: 15,503,671 (GRCm39) L297M possibly damaging Het
Dpp10 A G 1: 123,781,958 (GRCm39) S74P possibly damaging Het
Epha4 A G 1: 77,483,716 (GRCm39) Y98H possibly damaging Het
Epn3 T G 11: 94,383,762 (GRCm39) D296A probably damaging Het
Eri2 A C 7: 119,371,820 (GRCm39) I252S probably benign Het
Gp9 C T 6: 87,755,994 (GRCm39) T3I probably benign Het
H2-Q5 T A 17: 35,613,432 (GRCm39) V55E Het
Lct A T 1: 128,231,577 (GRCm39) N757K probably damaging Het
Lhx8 A C 3: 154,030,295 (GRCm39) N112K probably damaging Het
Loxl3 T A 6: 83,025,872 (GRCm39) S373R possibly damaging Het
Mettl4 G A 17: 95,041,077 (GRCm39) T359I probably damaging Het
Mpp7 A G 18: 7,444,096 (GRCm39) S109P probably damaging Het
Nckap5 A G 1: 125,954,032 (GRCm39) V840A probably benign Het
Ncoa4 T A 14: 31,898,893 (GRCm39) L571Q probably damaging Het
Or13a18 A T 7: 140,190,208 (GRCm39) Y35F possibly damaging Het
Or2f1 T C 6: 42,721,280 (GRCm39) F103S probably damaging Het
Phgdh G A 3: 98,228,561 (GRCm39) T204I probably damaging Het
Pla2g4d C T 2: 120,107,980 (GRCm39) V310M probably null Het
Prss3b T G 6: 41,008,622 (GRCm39) T231P possibly damaging Het
Psmd12 C T 11: 107,388,450 (GRCm39) P421L probably damaging Het
Ptch1 A G 13: 63,688,982 (GRCm39) Y432H probably damaging Het
Rapgef1 G A 2: 29,600,243 (GRCm39) G655S probably damaging Het
Rilpl2 C A 5: 124,616,097 (GRCm39) A18S probably damaging Het
Srsf7 T C 17: 80,512,815 (GRCm39) R88G probably benign Het
St6galnac1 T C 11: 116,660,059 (GRCm39) K85E possibly damaging Het
Trip12 A T 1: 84,773,488 (GRCm39) S49R probably damaging Het
Vinac1 T A 2: 128,880,091 (GRCm39) I612F Het
Wdr48 A G 9: 119,734,560 (GRCm39) T160A probably damaging Het
Zfp704 G A 3: 9,674,502 (GRCm39) T93M unknown Het
Other mutations in Kif3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0049:Kif3c UTSW 12 3,417,090 (GRCm39) missense possibly damaging 0.91
R0049:Kif3c UTSW 12 3,417,090 (GRCm39) missense possibly damaging 0.91
R0189:Kif3c UTSW 12 3,415,989 (GRCm39) missense probably benign 0.10
R0727:Kif3c UTSW 12 3,416,776 (GRCm39) missense probably benign 0.01
R0885:Kif3c UTSW 12 3,415,981 (GRCm39) start codon destroyed probably benign 0.00
R1796:Kif3c UTSW 12 3,417,299 (GRCm39) missense probably benign 0.01
R2229:Kif3c UTSW 12 3,416,671 (GRCm39) missense probably benign 0.01
R4728:Kif3c UTSW 12 3,415,873 (GRCm39) start gained probably benign
R4870:Kif3c UTSW 12 3,451,735 (GRCm39) missense probably damaging 1.00
R5586:Kif3c UTSW 12 3,439,656 (GRCm39) missense probably benign 0.41
R5662:Kif3c UTSW 12 3,417,031 (GRCm39) missense probably damaging 0.99
R6969:Kif3c UTSW 12 3,416,114 (GRCm39) missense probably benign 0.30
R7216:Kif3c UTSW 12 3,416,126 (GRCm39) missense probably benign 0.06
R7372:Kif3c UTSW 12 3,437,592 (GRCm39) missense probably benign 0.03
R7533:Kif3c UTSW 12 3,416,510 (GRCm39) missense probably damaging 1.00
R8917:Kif3c UTSW 12 3,416,690 (GRCm39) missense probably damaging 1.00
R9005:Kif3c UTSW 12 3,451,706 (GRCm39) missense probably damaging 1.00
R9348:Kif3c UTSW 12 3,417,505 (GRCm39) missense probably benign 0.00
X0052:Kif3c UTSW 12 3,417,027 (GRCm39) missense probably benign 0.30
X0064:Kif3c UTSW 12 3,416,868 (GRCm39) missense probably damaging 1.00
Z1177:Kif3c UTSW 12 3,417,245 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTGCATGCGGATTGAAG -3'
(R):5'- TGCCGTTGAAACCCTGAAG -3'

Sequencing Primer
(F):5'- ACTGATCCCGACCTAGGAGTAG -3'
(R):5'- GTTGAAACCCTGAAGCACTGAGTC -3'
Posted On 2020-09-02