Incidental Mutation 'R8373:Kif3c'
ID 646553
Institutional Source Beutler Lab
Gene Symbol Kif3c
Ensembl Gene ENSMUSG00000020668
Gene Name kinesin family member 3C
Synonyms N-4 kinesin
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock # R8373 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 3365132-3406494 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 3366089 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 37 (V37L)
Ref Sequence ENSEMBL: ENSMUSP00000020999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020999] [ENSMUST00000220210]
AlphaFold O35066
Predicted Effect probably benign
Transcript: ENSMUST00000020999
AA Change: V37L

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000020999
Gene: ENSMUSG00000020668
AA Change: V37L

DomainStartEndE-ValueType
KISc 8 375 5.43e-171 SMART
low complexity region 404 421 N/A INTRINSIC
low complexity region 435 443 N/A INTRINSIC
low complexity region 486 505 N/A INTRINSIC
Blast:KISc 508 579 3e-8 BLAST
low complexity region 580 602 N/A INTRINSIC
Blast:KISc 603 666 1e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000220210
AA Change: V37L

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik T G 6: 41,031,688 T231P possibly damaging Het
Adgrg6 T C 10: 14,467,334 T290A probably benign Het
Aff4 C T 11: 53,400,267 Q685* probably null Het
Ankmy1 A G 1: 92,896,094 M150T probably damaging Het
Armc1 T C 3: 19,149,567 Y65C probably damaging Het
Armc8 A G 9: 99,527,099 V222A probably benign Het
Bcar1 A T 8: 111,715,738 Y228* probably null Het
Cct2 T C 10: 117,060,824 D158G possibly damaging Het
Cul1 T A 6: 47,515,063 C426S possibly damaging Het
Deup1 G T 9: 15,592,375 L297M possibly damaging Het
Dpp10 A G 1: 123,854,229 S74P possibly damaging Het
Epha4 A G 1: 77,507,079 Y98H possibly damaging Het
Epn3 T G 11: 94,492,936 D296A probably damaging Het
Eri2 A C 7: 119,772,597 I252S probably benign Het
Gm14025 T A 2: 129,038,171 I612F Het
Gp9 C T 6: 87,779,012 T3I probably benign Het
H2-Q5 T A 17: 35,394,456 V55E Het
Lct A T 1: 128,303,840 N757K probably damaging Het
Lhx8 A C 3: 154,324,658 N112K probably damaging Het
Loxl3 T A 6: 83,048,891 S373R possibly damaging Het
Mettl4 G A 17: 94,733,649 T359I probably damaging Het
Mpp7 A G 18: 7,444,096 S109P probably damaging Het
Nckap5 A G 1: 126,026,295 V840A probably benign Het
Ncoa4 T A 14: 32,176,936 L571Q probably damaging Het
Olfr453 T C 6: 42,744,346 F103S probably damaging Het
Olfr46 A T 7: 140,610,295 Y35F possibly damaging Het
Phgdh G A 3: 98,321,245 T204I probably damaging Het
Pla2g4d C T 2: 120,277,499 V310M probably null Het
Psmd12 C T 11: 107,497,624 P421L probably damaging Het
Ptch1 A G 13: 63,541,168 Y432H probably damaging Het
Rapgef1 G A 2: 29,710,231 G655S probably damaging Het
Rilpl2 C A 5: 124,478,034 A18S probably damaging Het
Srsf7 T C 17: 80,205,386 R88G probably benign Het
St6galnac1 T C 11: 116,769,233 K85E possibly damaging Het
Trip12 A T 1: 84,795,767 S49R probably damaging Het
Wdr48 A G 9: 119,905,494 T160A probably damaging Het
Zfp704 G A 3: 9,609,442 T93M unknown Het
Other mutations in Kif3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0049:Kif3c UTSW 12 3367090 missense possibly damaging 0.91
R0049:Kif3c UTSW 12 3367090 missense possibly damaging 0.91
R0189:Kif3c UTSW 12 3365989 missense probably benign 0.10
R0727:Kif3c UTSW 12 3366776 missense probably benign 0.01
R0885:Kif3c UTSW 12 3365981 start codon destroyed probably benign 0.00
R1796:Kif3c UTSW 12 3367299 missense probably benign 0.01
R2229:Kif3c UTSW 12 3366671 missense probably benign 0.01
R4728:Kif3c UTSW 12 3365873 start gained probably benign
R4870:Kif3c UTSW 12 3401735 missense probably damaging 1.00
R5586:Kif3c UTSW 12 3389656 missense probably benign 0.41
R5662:Kif3c UTSW 12 3367031 missense probably damaging 0.99
R6969:Kif3c UTSW 12 3366114 missense probably benign 0.30
R7216:Kif3c UTSW 12 3366126 missense probably benign 0.06
R7372:Kif3c UTSW 12 3387592 missense probably benign 0.03
R7533:Kif3c UTSW 12 3366510 missense probably damaging 1.00
R8917:Kif3c UTSW 12 3366690 missense probably damaging 1.00
R9005:Kif3c UTSW 12 3401706 missense probably damaging 1.00
R9348:Kif3c UTSW 12 3367505 missense probably benign 0.00
X0052:Kif3c UTSW 12 3367027 missense probably benign 0.30
X0064:Kif3c UTSW 12 3366868 missense probably damaging 1.00
Z1177:Kif3c UTSW 12 3367245 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTGCATGCGGATTGAAG -3'
(R):5'- TGCCGTTGAAACCCTGAAG -3'

Sequencing Primer
(F):5'- ACTGATCCCGACCTAGGAGTAG -3'
(R):5'- GTTGAAACCCTGAAGCACTGAGTC -3'
Posted On 2020-09-02