Incidental Mutation 'R8373:Ptch1'
ID 646554
Institutional Source Beutler Lab
Gene Symbol Ptch1
Ensembl Gene ENSMUSG00000021466
Gene Name patched 1
Synonyms A230106A15Rik, Patched 1, Ptc1, Ptc
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8373 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 63508328-63573598 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 63541168 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 432 (Y432H)
Ref Sequence ENSEMBL: ENSMUSP00000021921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021921] [ENSMUST00000192155] [ENSMUST00000193953] [ENSMUST00000194663] [ENSMUST00000195106] [ENSMUST00000195258] [ENSMUST00000195756]
AlphaFold Q61115
Predicted Effect probably damaging
Transcript: ENSMUST00000021921
AA Change: Y432H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021921
Gene: ENSMUSG00000021466
AA Change: Y432H

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
Pfam:Patched 351 871 7.6e-47 PFAM
Pfam:Sterol-sensing 448 602 1.5e-45 PFAM
Pfam:Patched 952 1166 9.8e-33 PFAM
low complexity region 1180 1189 N/A INTRINSIC
low complexity region 1204 1213 N/A INTRINSIC
low complexity region 1281 1296 N/A INTRINSIC
low complexity region 1355 1367 N/A INTRINSIC
low complexity region 1369 1384 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192155
AA Change: Y295H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141489
Gene: ENSMUSG00000021466
AA Change: Y295H

DomainStartEndE-ValueType
Pfam:Patched 214 733 3.1e-44 PFAM
Pfam:Sterol-sensing 311 465 2.8e-46 PFAM
Pfam:Patched 814 1029 3.1e-30 PFAM
low complexity region 1043 1052 N/A INTRINSIC
low complexity region 1067 1076 N/A INTRINSIC
low complexity region 1144 1159 N/A INTRINSIC
low complexity region 1218 1230 N/A INTRINSIC
low complexity region 1232 1247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193953
Predicted Effect probably damaging
Transcript: ENSMUST00000194663
AA Change: Y380H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141766
Gene: ENSMUSG00000021466
AA Change: Y380H

DomainStartEndE-ValueType
Pfam:Patched 298 569 4.7e-34 PFAM
Pfam:Sterol-sensing 396 550 7.9e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195106
SMART Domains Protein: ENSMUSP00000141298
Gene: ENSMUSG00000021466

DomainStartEndE-ValueType
low complexity region 38 59 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000141309
Gene: ENSMUSG00000021466
AA Change: Y325H

DomainStartEndE-ValueType
Pfam:Patched 212 426 7.8e-28 PFAM
Pfam:Sterol-sensing 311 426 8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195756
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the patched gene family. The encoded protein is the receptor for sonic hedgehog, a secreted molecule implicated in the formation of embryonic structures and in tumorigenesis, as well as the desert hedgehog and indian hedgehog proteins. This gene functions as a tumor suppressor. Mutations of this gene have been associated with basal cell nevus syndrome, esophageal squamous cell carcinoma, trichoepitheliomas, transitional cell carcinomas of the bladder, as well as holoprosencephaly. Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences and biological validity cannot be determined currently. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die by day 10 with neural tube defects. Heterozygotes are large with excess cerebellar granule cell proliferation and sometimes, hindlimb defects and medulloblastomas. Hypomorphic and spontaneous mutants have reproductive defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik T G 6: 41,031,688 T231P possibly damaging Het
Adgrg6 T C 10: 14,467,334 T290A probably benign Het
Aff4 C T 11: 53,400,267 Q685* probably null Het
Ankmy1 A G 1: 92,896,094 M150T probably damaging Het
Armc1 T C 3: 19,149,567 Y65C probably damaging Het
Armc8 A G 9: 99,527,099 V222A probably benign Het
Bcar1 A T 8: 111,715,738 Y228* probably null Het
Cct2 T C 10: 117,060,824 D158G possibly damaging Het
Cul1 T A 6: 47,515,063 C426S possibly damaging Het
Deup1 G T 9: 15,592,375 L297M possibly damaging Het
Dpp10 A G 1: 123,854,229 S74P possibly damaging Het
Epha4 A G 1: 77,507,079 Y98H possibly damaging Het
Epn3 T G 11: 94,492,936 D296A probably damaging Het
Eri2 A C 7: 119,772,597 I252S probably benign Het
Gm14025 T A 2: 129,038,171 I612F Het
Gp9 C T 6: 87,779,012 T3I probably benign Het
H2-Q5 T A 17: 35,394,456 V55E Het
Kif3c G T 12: 3,366,089 V37L probably benign Het
Lct A T 1: 128,303,840 N757K probably damaging Het
Lhx8 A C 3: 154,324,658 N112K probably damaging Het
Loxl3 T A 6: 83,048,891 S373R possibly damaging Het
Mettl4 G A 17: 94,733,649 T359I probably damaging Het
Mpp7 A G 18: 7,444,096 S109P probably damaging Het
Nckap5 A G 1: 126,026,295 V840A probably benign Het
Ncoa4 T A 14: 32,176,936 L571Q probably damaging Het
Olfr453 T C 6: 42,744,346 F103S probably damaging Het
Olfr46 A T 7: 140,610,295 Y35F possibly damaging Het
Phgdh G A 3: 98,321,245 T204I probably damaging Het
Pla2g4d C T 2: 120,277,499 V310M probably null Het
Psmd12 C T 11: 107,497,624 P421L probably damaging Het
Rapgef1 G A 2: 29,710,231 G655S probably damaging Het
Rilpl2 C A 5: 124,478,034 A18S probably damaging Het
Srsf7 T C 17: 80,205,386 R88G probably benign Het
St6galnac1 T C 11: 116,769,233 K85E possibly damaging Het
Trip12 A T 1: 84,795,767 S49R probably damaging Het
Wdr48 A G 9: 119,905,494 T160A probably damaging Het
Zfp704 G A 3: 9,609,442 T93M unknown Het
Other mutations in Ptch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Ptch1 APN 13 63527175 missense probably benign 0.00
IGL01084:Ptch1 APN 13 63543637 missense probably damaging 0.99
IGL01369:Ptch1 APN 13 63511681 missense probably benign
IGL02260:Ptch1 APN 13 63565352 unclassified probably benign
IGL02439:Ptch1 APN 13 63545096 missense probably damaging 1.00
IGL02588:Ptch1 APN 13 63511918 missense probably benign 0.13
IGL02797:Ptch1 APN 13 63533607 missense probably benign
R0463:Ptch1 UTSW 13 63520307 missense probably damaging 0.98
R0539:Ptch1 UTSW 13 63543480 splice site probably benign
R0657:Ptch1 UTSW 13 63513751 missense possibly damaging 0.90
R0971:Ptch1 UTSW 13 63539843 missense probably benign 0.23
R1466:Ptch1 UTSW 13 63524969 missense probably benign 0.02
R1466:Ptch1 UTSW 13 63524969 missense probably benign 0.02
R1539:Ptch1 UTSW 13 63541287 missense probably benign 0.00
R1616:Ptch1 UTSW 13 63539842 missense possibly damaging 0.96
R1883:Ptch1 UTSW 13 63512027 nonsense probably null
R1985:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R1986:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2024:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2025:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2026:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2027:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2096:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2097:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2100:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2105:Ptch1 UTSW 13 63545245 missense probably benign
R2165:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2166:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2167:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2168:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2226:Ptch1 UTSW 13 63513671 missense probably damaging 1.00
R2437:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2504:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2507:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2696:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2698:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2698:Ptch1 UTSW 13 63542224 missense probably damaging 1.00
R2971:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3410:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3708:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3744:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3745:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3783:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3784:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3785:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3807:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3950:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4013:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4015:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4016:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4017:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4035:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4083:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4084:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4179:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4222:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4348:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4349:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4350:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4351:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4353:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4485:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4595:Ptch1 UTSW 13 63543608 missense possibly damaging 0.68
R4625:Ptch1 UTSW 13 63523164 missense probably benign 0.02
R4809:Ptch1 UTSW 13 63513708 missense probably damaging 0.98
R4904:Ptch1 UTSW 13 63523004 missense probably damaging 1.00
R4911:Ptch1 UTSW 13 63523052 missense probably damaging 1.00
R4942:Ptch1 UTSW 13 63525070 missense probably benign 0.02
R5386:Ptch1 UTSW 13 63545043 missense probably damaging 0.98
R5447:Ptch1 UTSW 13 63527245 missense probably benign
R5604:Ptch1 UTSW 13 63525122 missense probably benign 0.01
R5846:Ptch1 UTSW 13 63565454 unclassified probably benign
R5926:Ptch1 UTSW 13 63545055 missense probably benign 0.01
R5945:Ptch1 UTSW 13 63573419 utr 5 prime probably benign
R5957:Ptch1 UTSW 13 63525115 missense probably damaging 1.00
R6326:Ptch1 UTSW 13 63543545 missense probably damaging 1.00
R6358:Ptch1 UTSW 13 63513689 missense probably damaging 0.96
R6376:Ptch1 UTSW 13 63543608 missense possibly damaging 0.68
R6599:Ptch1 UTSW 13 63523104 missense probably damaging 0.98
R6615:Ptch1 UTSW 13 63539830 missense possibly damaging 0.46
R6965:Ptch1 UTSW 13 63525067 missense possibly damaging 0.63
R7149:Ptch1 UTSW 13 63511736 missense probably benign 0.23
R7168:Ptch1 UTSW 13 63512060 missense probably benign
R7257:Ptch1 UTSW 13 63573294 missense not run
R7258:Ptch1 UTSW 13 63573294 missense not run
R7259:Ptch1 UTSW 13 63573294 missense not run
R7368:Ptch1 UTSW 13 63511984 missense probably benign 0.06
R7525:Ptch1 UTSW 13 63511714 missense probably benign 0.00
R7528:Ptch1 UTSW 13 63511714 missense probably benign 0.00
R7820:Ptch1 UTSW 13 63523061 missense probably damaging 1.00
R8077:Ptch1 UTSW 13 63540812 missense probably damaging 0.98
R8398:Ptch1 UTSW 13 63525125 missense probably benign 0.06
R8407:Ptch1 UTSW 13 63514243 missense probably null 1.00
R8839:Ptch1 UTSW 13 63541224 missense probably damaging 1.00
R9075:Ptch1 UTSW 13 63533521 missense possibly damaging 0.87
R9476:Ptch1 UTSW 13 63533634 missense probably benign 0.05
R9514:Ptch1 UTSW 13 63527257 missense probably benign
R9528:Ptch1 UTSW 13 63513801 missense probably benign 0.00
R9568:Ptch1 UTSW 13 63542173 missense probably damaging 0.99
Z1177:Ptch1 UTSW 13 63520279 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTGCAAGCAGAACGATTGG -3'
(R):5'- TGGTGTTCCCCAAGTCTGTG -3'

Sequencing Primer
(F):5'- GTAACAATTCTAACGTTTTACCCACC -3'
(R):5'- CAAGTCTGTGCTCTTGTTGC -3'
Posted On 2020-09-02