Incidental Mutation 'R8373:Ptch1'
ID 646554
Institutional Source Beutler Lab
Gene Symbol Ptch1
Ensembl Gene ENSMUSG00000021466
Gene Name patched 1
Synonyms wig, Ptc, Ptc1, A230106A15Rik, Patched 1
MMRRC Submission 067741-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8373 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 63656142-63721274 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 63688982 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 432 (Y432H)
Ref Sequence ENSEMBL: ENSMUSP00000021921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021921] [ENSMUST00000192155] [ENSMUST00000193953] [ENSMUST00000194663] [ENSMUST00000195106] [ENSMUST00000195258] [ENSMUST00000195756]
AlphaFold Q61115
Predicted Effect probably damaging
Transcript: ENSMUST00000021921
AA Change: Y432H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021921
Gene: ENSMUSG00000021466
AA Change: Y432H

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
Pfam:Patched 351 871 7.6e-47 PFAM
Pfam:Sterol-sensing 448 602 1.5e-45 PFAM
Pfam:Patched 952 1166 9.8e-33 PFAM
low complexity region 1180 1189 N/A INTRINSIC
low complexity region 1204 1213 N/A INTRINSIC
low complexity region 1281 1296 N/A INTRINSIC
low complexity region 1355 1367 N/A INTRINSIC
low complexity region 1369 1384 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192155
AA Change: Y295H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141489
Gene: ENSMUSG00000021466
AA Change: Y295H

DomainStartEndE-ValueType
Pfam:Patched 214 733 3.1e-44 PFAM
Pfam:Sterol-sensing 311 465 2.8e-46 PFAM
Pfam:Patched 814 1029 3.1e-30 PFAM
low complexity region 1043 1052 N/A INTRINSIC
low complexity region 1067 1076 N/A INTRINSIC
low complexity region 1144 1159 N/A INTRINSIC
low complexity region 1218 1230 N/A INTRINSIC
low complexity region 1232 1247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193953
Predicted Effect probably damaging
Transcript: ENSMUST00000194663
AA Change: Y380H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141766
Gene: ENSMUSG00000021466
AA Change: Y380H

DomainStartEndE-ValueType
Pfam:Patched 298 569 4.7e-34 PFAM
Pfam:Sterol-sensing 396 550 7.9e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195106
SMART Domains Protein: ENSMUSP00000141298
Gene: ENSMUSG00000021466

DomainStartEndE-ValueType
low complexity region 38 59 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000141309
Gene: ENSMUSG00000021466
AA Change: Y325H

DomainStartEndE-ValueType
Pfam:Patched 212 426 7.8e-28 PFAM
Pfam:Sterol-sensing 311 426 8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195756
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the patched gene family. The encoded protein is the receptor for sonic hedgehog, a secreted molecule implicated in the formation of embryonic structures and in tumorigenesis, as well as the desert hedgehog and indian hedgehog proteins. This gene functions as a tumor suppressor. Mutations of this gene have been associated with basal cell nevus syndrome, esophageal squamous cell carcinoma, trichoepitheliomas, transitional cell carcinomas of the bladder, as well as holoprosencephaly. Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences and biological validity cannot be determined currently. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die by day 10 with neural tube defects. Heterozygotes are large with excess cerebellar granule cell proliferation and sometimes, hindlimb defects and medulloblastomas. Hypomorphic and spontaneous mutants have reproductive defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 T C 10: 14,343,078 (GRCm39) T290A probably benign Het
Aff4 C T 11: 53,291,094 (GRCm39) Q685* probably null Het
Ankmy1 A G 1: 92,823,816 (GRCm39) M150T probably damaging Het
Armc1 T C 3: 19,203,731 (GRCm39) Y65C probably damaging Het
Armc8 A G 9: 99,409,152 (GRCm39) V222A probably benign Het
Bcar1 A T 8: 112,442,370 (GRCm39) Y228* probably null Het
Cct2 T C 10: 116,896,729 (GRCm39) D158G possibly damaging Het
Cul1 T A 6: 47,491,997 (GRCm39) C426S possibly damaging Het
Deup1 G T 9: 15,503,671 (GRCm39) L297M possibly damaging Het
Dpp10 A G 1: 123,781,958 (GRCm39) S74P possibly damaging Het
Epha4 A G 1: 77,483,716 (GRCm39) Y98H possibly damaging Het
Epn3 T G 11: 94,383,762 (GRCm39) D296A probably damaging Het
Eri2 A C 7: 119,371,820 (GRCm39) I252S probably benign Het
Gp9 C T 6: 87,755,994 (GRCm39) T3I probably benign Het
H2-Q5 T A 17: 35,613,432 (GRCm39) V55E Het
Kif3c G T 12: 3,416,089 (GRCm39) V37L probably benign Het
Lct A T 1: 128,231,577 (GRCm39) N757K probably damaging Het
Lhx8 A C 3: 154,030,295 (GRCm39) N112K probably damaging Het
Loxl3 T A 6: 83,025,872 (GRCm39) S373R possibly damaging Het
Mettl4 G A 17: 95,041,077 (GRCm39) T359I probably damaging Het
Mpp7 A G 18: 7,444,096 (GRCm39) S109P probably damaging Het
Nckap5 A G 1: 125,954,032 (GRCm39) V840A probably benign Het
Ncoa4 T A 14: 31,898,893 (GRCm39) L571Q probably damaging Het
Or13a18 A T 7: 140,190,208 (GRCm39) Y35F possibly damaging Het
Or2f1 T C 6: 42,721,280 (GRCm39) F103S probably damaging Het
Phgdh G A 3: 98,228,561 (GRCm39) T204I probably damaging Het
Pla2g4d C T 2: 120,107,980 (GRCm39) V310M probably null Het
Prss3b T G 6: 41,008,622 (GRCm39) T231P possibly damaging Het
Psmd12 C T 11: 107,388,450 (GRCm39) P421L probably damaging Het
Rapgef1 G A 2: 29,600,243 (GRCm39) G655S probably damaging Het
Rilpl2 C A 5: 124,616,097 (GRCm39) A18S probably damaging Het
Srsf7 T C 17: 80,512,815 (GRCm39) R88G probably benign Het
St6galnac1 T C 11: 116,660,059 (GRCm39) K85E possibly damaging Het
Trip12 A T 1: 84,773,488 (GRCm39) S49R probably damaging Het
Vinac1 T A 2: 128,880,091 (GRCm39) I612F Het
Wdr48 A G 9: 119,734,560 (GRCm39) T160A probably damaging Het
Zfp704 G A 3: 9,674,502 (GRCm39) T93M unknown Het
Other mutations in Ptch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Ptch1 APN 13 63,674,989 (GRCm39) missense probably benign 0.00
IGL01084:Ptch1 APN 13 63,691,451 (GRCm39) missense probably damaging 0.99
IGL01369:Ptch1 APN 13 63,659,495 (GRCm39) missense probably benign
IGL02260:Ptch1 APN 13 63,713,166 (GRCm39) unclassified probably benign
IGL02439:Ptch1 APN 13 63,692,910 (GRCm39) missense probably damaging 1.00
IGL02588:Ptch1 APN 13 63,659,732 (GRCm39) missense probably benign 0.13
IGL02797:Ptch1 APN 13 63,681,421 (GRCm39) missense probably benign
R0463:Ptch1 UTSW 13 63,668,121 (GRCm39) missense probably damaging 0.98
R0539:Ptch1 UTSW 13 63,691,294 (GRCm39) splice site probably benign
R0657:Ptch1 UTSW 13 63,661,565 (GRCm39) missense possibly damaging 0.90
R0971:Ptch1 UTSW 13 63,687,657 (GRCm39) missense probably benign 0.23
R1466:Ptch1 UTSW 13 63,672,783 (GRCm39) missense probably benign 0.02
R1466:Ptch1 UTSW 13 63,672,783 (GRCm39) missense probably benign 0.02
R1539:Ptch1 UTSW 13 63,689,101 (GRCm39) missense probably benign 0.00
R1616:Ptch1 UTSW 13 63,687,656 (GRCm39) missense possibly damaging 0.96
R1883:Ptch1 UTSW 13 63,659,841 (GRCm39) nonsense probably null
R1985:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R1986:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2024:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2025:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2026:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2027:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2096:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2097:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2100:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2105:Ptch1 UTSW 13 63,693,059 (GRCm39) missense probably benign
R2165:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2166:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2167:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2168:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2226:Ptch1 UTSW 13 63,661,485 (GRCm39) missense probably damaging 1.00
R2437:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2504:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2507:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2696:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2698:Ptch1 UTSW 13 63,690,038 (GRCm39) missense probably damaging 1.00
R2698:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2971:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3410:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3708:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3744:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3745:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3783:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3784:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3785:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3807:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3950:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4013:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4015:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4016:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4017:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4035:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4083:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4084:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4179:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4222:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4348:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4349:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4350:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4351:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4353:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4485:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4595:Ptch1 UTSW 13 63,691,422 (GRCm39) missense possibly damaging 0.68
R4625:Ptch1 UTSW 13 63,670,978 (GRCm39) missense probably benign 0.02
R4809:Ptch1 UTSW 13 63,661,522 (GRCm39) missense probably damaging 0.98
R4904:Ptch1 UTSW 13 63,670,818 (GRCm39) missense probably damaging 1.00
R4911:Ptch1 UTSW 13 63,670,866 (GRCm39) missense probably damaging 1.00
R4942:Ptch1 UTSW 13 63,672,884 (GRCm39) missense probably benign 0.02
R5386:Ptch1 UTSW 13 63,692,857 (GRCm39) missense probably damaging 0.98
R5447:Ptch1 UTSW 13 63,675,059 (GRCm39) missense probably benign
R5604:Ptch1 UTSW 13 63,672,936 (GRCm39) missense probably benign 0.01
R5846:Ptch1 UTSW 13 63,713,268 (GRCm39) unclassified probably benign
R5926:Ptch1 UTSW 13 63,692,869 (GRCm39) missense probably benign 0.01
R5945:Ptch1 UTSW 13 63,721,233 (GRCm39) utr 5 prime probably benign
R5957:Ptch1 UTSW 13 63,672,929 (GRCm39) missense probably damaging 1.00
R6326:Ptch1 UTSW 13 63,691,359 (GRCm39) missense probably damaging 1.00
R6358:Ptch1 UTSW 13 63,661,503 (GRCm39) missense probably damaging 0.96
R6376:Ptch1 UTSW 13 63,691,422 (GRCm39) missense possibly damaging 0.68
R6599:Ptch1 UTSW 13 63,670,918 (GRCm39) missense probably damaging 0.98
R6615:Ptch1 UTSW 13 63,687,644 (GRCm39) missense possibly damaging 0.46
R6965:Ptch1 UTSW 13 63,672,881 (GRCm39) missense possibly damaging 0.63
R7149:Ptch1 UTSW 13 63,659,550 (GRCm39) missense probably benign 0.23
R7168:Ptch1 UTSW 13 63,659,874 (GRCm39) missense probably benign
R7257:Ptch1 UTSW 13 63,721,108 (GRCm39) missense not run
R7258:Ptch1 UTSW 13 63,721,108 (GRCm39) missense not run
R7259:Ptch1 UTSW 13 63,721,108 (GRCm39) missense not run
R7368:Ptch1 UTSW 13 63,659,798 (GRCm39) missense probably benign 0.06
R7525:Ptch1 UTSW 13 63,659,528 (GRCm39) missense probably benign 0.00
R7528:Ptch1 UTSW 13 63,659,528 (GRCm39) missense probably benign 0.00
R7820:Ptch1 UTSW 13 63,670,875 (GRCm39) missense probably damaging 1.00
R8077:Ptch1 UTSW 13 63,688,626 (GRCm39) missense probably damaging 0.98
R8398:Ptch1 UTSW 13 63,672,939 (GRCm39) missense probably benign 0.06
R8407:Ptch1 UTSW 13 63,662,057 (GRCm39) missense probably null 1.00
R8839:Ptch1 UTSW 13 63,689,038 (GRCm39) missense probably damaging 1.00
R9075:Ptch1 UTSW 13 63,681,335 (GRCm39) missense possibly damaging 0.87
R9476:Ptch1 UTSW 13 63,681,448 (GRCm39) missense probably benign 0.05
R9514:Ptch1 UTSW 13 63,675,071 (GRCm39) missense probably benign
R9528:Ptch1 UTSW 13 63,661,615 (GRCm39) missense probably benign 0.00
R9568:Ptch1 UTSW 13 63,689,987 (GRCm39) missense probably damaging 0.99
Z1177:Ptch1 UTSW 13 63,668,093 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTGCAAGCAGAACGATTGG -3'
(R):5'- TGGTGTTCCCCAAGTCTGTG -3'

Sequencing Primer
(F):5'- GTAACAATTCTAACGTTTTACCCACC -3'
(R):5'- CAAGTCTGTGCTCTTGTTGC -3'
Posted On 2020-09-02