Incidental Mutation 'R8373:Srsf7'
ID 646557
Institutional Source Beutler Lab
Gene Symbol Srsf7
Ensembl Gene ENSMUSG00000024097
Gene Name serine/arginine-rich splicing factor 7
Synonyms Sfrs7, 9430065L19Rik, 9G8, NX-96
MMRRC Submission 067741-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8373 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 80200089-80207305 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80205386 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 88 (R88G)
Ref Sequence ENSEMBL: ENSMUSP00000070983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063417] [ENSMUST00000134652]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000063417
AA Change: R88G

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000070983
Gene: ENSMUSG00000024097
AA Change: R88G

DomainStartEndE-ValueType
RRM 12 80 1.66e-20 SMART
ZnF_C2HC 105 121 1.77e-2 SMART
low complexity region 192 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134652
SMART Domains Protein: ENSMUSP00000123158
Gene: ENSMUSG00000046196

DomainStartEndE-ValueType
Pfam:DUF3808 69 522 7.2e-150 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Five transcript variants, four of them protein-coding and the other not protein-coding, have been found for this gene. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik T G 6: 41,031,688 T231P possibly damaging Het
Adgrg6 T C 10: 14,467,334 T290A probably benign Het
Aff4 C T 11: 53,400,267 Q685* probably null Het
Ankmy1 A G 1: 92,896,094 M150T probably damaging Het
Armc1 T C 3: 19,149,567 Y65C probably damaging Het
Armc8 A G 9: 99,527,099 V222A probably benign Het
Bcar1 A T 8: 111,715,738 Y228* probably null Het
Cct2 T C 10: 117,060,824 D158G possibly damaging Het
Cul1 T A 6: 47,515,063 C426S possibly damaging Het
Deup1 G T 9: 15,592,375 L297M possibly damaging Het
Dpp10 A G 1: 123,854,229 S74P possibly damaging Het
Epha4 A G 1: 77,507,079 Y98H possibly damaging Het
Epn3 T G 11: 94,492,936 D296A probably damaging Het
Eri2 A C 7: 119,772,597 I252S probably benign Het
Gm14025 T A 2: 129,038,171 I612F Het
Gp9 C T 6: 87,779,012 T3I probably benign Het
H2-Q5 T A 17: 35,394,456 V55E Het
Kif3c G T 12: 3,366,089 V37L probably benign Het
Lct A T 1: 128,303,840 N757K probably damaging Het
Lhx8 A C 3: 154,324,658 N112K probably damaging Het
Loxl3 T A 6: 83,048,891 S373R possibly damaging Het
Mettl4 G A 17: 94,733,649 T359I probably damaging Het
Mpp7 A G 18: 7,444,096 S109P probably damaging Het
Nckap5 A G 1: 126,026,295 V840A probably benign Het
Ncoa4 T A 14: 32,176,936 L571Q probably damaging Het
Olfr453 T C 6: 42,744,346 F103S probably damaging Het
Olfr46 A T 7: 140,610,295 Y35F possibly damaging Het
Phgdh G A 3: 98,321,245 T204I probably damaging Het
Pla2g4d C T 2: 120,277,499 V310M probably null Het
Psmd12 C T 11: 107,497,624 P421L probably damaging Het
Ptch1 A G 13: 63,541,168 Y432H probably damaging Het
Rapgef1 G A 2: 29,710,231 G655S probably damaging Het
Rilpl2 C A 5: 124,478,034 A18S probably damaging Het
St6galnac1 T C 11: 116,769,233 K85E possibly damaging Het
Trip12 A T 1: 84,795,767 S49R probably damaging Het
Wdr48 A G 9: 119,905,494 T160A probably damaging Het
Zfp704 G A 3: 9,609,442 T93M unknown Het
Other mutations in Srsf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02059:Srsf7 APN 17 80202692 missense probably null
IGL02544:Srsf7 APN 17 80204191 unclassified probably benign
R1036:Srsf7 UTSW 17 80205837 unclassified probably benign
R3014:Srsf7 UTSW 17 80201561 missense unknown
R6004:Srsf7 UTSW 17 80205853 missense probably damaging 1.00
R6298:Srsf7 UTSW 17 80207253 unclassified probably benign
R6551:Srsf7 UTSW 17 80204219 unclassified probably benign
R7683:Srsf7 UTSW 17 80207274 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AAACACTAGTTTCTGCCTTGC -3'
(R):5'- CACATGCCTTACCCTTCAGG -3'

Sequencing Primer
(F):5'- ACTAGTTTCTGCCTTGCTAATAAAAG -3'
(R):5'- GGCACTGGATAACTTAAGATTTAGG -3'
Posted On 2020-09-02