Incidental Mutation 'R8373:Mpp7'
ID 646559
Institutional Source Beutler Lab
Gene Symbol Mpp7
Ensembl Gene ENSMUSG00000057440
Gene Name membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)
Synonyms 2810038M04Rik, LOC381166, 5430426E14Rik, 1110068J02Rik
MMRRC Submission 067741-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.145) question?
Stock # R8373 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 7347959-7626866 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 7444096 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 109 (S109P)
Ref Sequence ENSEMBL: ENSMUSP00000111535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115869]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000115869
AA Change: S109P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111535
Gene: ENSMUSG00000057440
AA Change: S109P

DomainStartEndE-ValueType
L27 10 68 7.05e-14 SMART
L27 72 125 3.72e-13 SMART
PDZ 147 220 3.8e-15 SMART
SH3 231 297 1.4e-11 SMART
low complexity region 317 328 N/A INTRINSIC
GuKc 367 563 4.01e-65 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the p55 Stardust family of membrane-associated guanylate kinase (MAGUK) proteins, which function in the establishment of epithelial cell polarity. This family member forms a complex with the polarity protein DLG1 (discs, large homolog 1) and facilitates epithelial cell polarity and tight junction formation. Polymorphisms in this gene are associated with variations in site-specific bone mineral density (BMD). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 T C 10: 14,343,078 (GRCm39) T290A probably benign Het
Aff4 C T 11: 53,291,094 (GRCm39) Q685* probably null Het
Ankmy1 A G 1: 92,823,816 (GRCm39) M150T probably damaging Het
Armc1 T C 3: 19,203,731 (GRCm39) Y65C probably damaging Het
Armc8 A G 9: 99,409,152 (GRCm39) V222A probably benign Het
Bcar1 A T 8: 112,442,370 (GRCm39) Y228* probably null Het
Cct2 T C 10: 116,896,729 (GRCm39) D158G possibly damaging Het
Cul1 T A 6: 47,491,997 (GRCm39) C426S possibly damaging Het
Deup1 G T 9: 15,503,671 (GRCm39) L297M possibly damaging Het
Dpp10 A G 1: 123,781,958 (GRCm39) S74P possibly damaging Het
Epha4 A G 1: 77,483,716 (GRCm39) Y98H possibly damaging Het
Epn3 T G 11: 94,383,762 (GRCm39) D296A probably damaging Het
Eri2 A C 7: 119,371,820 (GRCm39) I252S probably benign Het
Gp9 C T 6: 87,755,994 (GRCm39) T3I probably benign Het
H2-Q5 T A 17: 35,613,432 (GRCm39) V55E Het
Kif3c G T 12: 3,416,089 (GRCm39) V37L probably benign Het
Lct A T 1: 128,231,577 (GRCm39) N757K probably damaging Het
Lhx8 A C 3: 154,030,295 (GRCm39) N112K probably damaging Het
Loxl3 T A 6: 83,025,872 (GRCm39) S373R possibly damaging Het
Mettl4 G A 17: 95,041,077 (GRCm39) T359I probably damaging Het
Nckap5 A G 1: 125,954,032 (GRCm39) V840A probably benign Het
Ncoa4 T A 14: 31,898,893 (GRCm39) L571Q probably damaging Het
Or13a18 A T 7: 140,190,208 (GRCm39) Y35F possibly damaging Het
Or2f1 T C 6: 42,721,280 (GRCm39) F103S probably damaging Het
Phgdh G A 3: 98,228,561 (GRCm39) T204I probably damaging Het
Pla2g4d C T 2: 120,107,980 (GRCm39) V310M probably null Het
Prss3b T G 6: 41,008,622 (GRCm39) T231P possibly damaging Het
Psmd12 C T 11: 107,388,450 (GRCm39) P421L probably damaging Het
Ptch1 A G 13: 63,688,982 (GRCm39) Y432H probably damaging Het
Rapgef1 G A 2: 29,600,243 (GRCm39) G655S probably damaging Het
Rilpl2 C A 5: 124,616,097 (GRCm39) A18S probably damaging Het
Srsf7 T C 17: 80,512,815 (GRCm39) R88G probably benign Het
St6galnac1 T C 11: 116,660,059 (GRCm39) K85E possibly damaging Het
Trip12 A T 1: 84,773,488 (GRCm39) S49R probably damaging Het
Vinac1 T A 2: 128,880,091 (GRCm39) I612F Het
Wdr48 A G 9: 119,734,560 (GRCm39) T160A probably damaging Het
Zfp704 G A 3: 9,674,502 (GRCm39) T93M unknown Het
Other mutations in Mpp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Mpp7 APN 18 7,353,297 (GRCm39) missense probably benign 0.00
IGL01575:Mpp7 APN 18 7,403,365 (GRCm39) splice site probably benign
IGL02973:Mpp7 APN 18 7,403,297 (GRCm39) missense probably damaging 1.00
IGL02985:Mpp7 APN 18 7,461,637 (GRCm39) critical splice donor site probably null
IGL03224:Mpp7 APN 18 7,403,269 (GRCm39) missense probably benign 0.28
IGL03248:Mpp7 APN 18 7,403,269 (GRCm39) missense probably benign 0.28
R0040:Mpp7 UTSW 18 7,403,180 (GRCm39) splice site probably benign
R0089:Mpp7 UTSW 18 7,439,555 (GRCm39) splice site probably benign
R1413:Mpp7 UTSW 18 7,350,977 (GRCm39) missense probably damaging 1.00
R1634:Mpp7 UTSW 18 7,350,984 (GRCm39) missense possibly damaging 0.63
R1859:Mpp7 UTSW 18 7,350,967 (GRCm39) makesense probably null
R2379:Mpp7 UTSW 18 7,403,345 (GRCm39) nonsense probably null
R2869:Mpp7 UTSW 18 7,461,678 (GRCm39) missense possibly damaging 0.76
R2869:Mpp7 UTSW 18 7,461,678 (GRCm39) missense possibly damaging 0.76
R2871:Mpp7 UTSW 18 7,461,678 (GRCm39) missense possibly damaging 0.76
R2871:Mpp7 UTSW 18 7,461,678 (GRCm39) missense possibly damaging 0.76
R3008:Mpp7 UTSW 18 7,461,678 (GRCm39) missense possibly damaging 0.76
R3009:Mpp7 UTSW 18 7,461,678 (GRCm39) missense possibly damaging 0.76
R3010:Mpp7 UTSW 18 7,461,678 (GRCm39) missense possibly damaging 0.76
R3782:Mpp7 UTSW 18 7,351,085 (GRCm39) missense probably damaging 0.99
R3980:Mpp7 UTSW 18 7,444,062 (GRCm39) missense probably benign 0.23
R4574:Mpp7 UTSW 18 7,353,228 (GRCm39) missense probably benign 0.02
R4772:Mpp7 UTSW 18 7,379,983 (GRCm39) splice site probably null
R5066:Mpp7 UTSW 18 7,513,002 (GRCm39) missense possibly damaging 0.95
R5437:Mpp7 UTSW 18 7,458,930 (GRCm39) critical splice donor site probably null
R5451:Mpp7 UTSW 18 7,442,855 (GRCm39) missense probably null 0.95
R5578:Mpp7 UTSW 18 7,355,101 (GRCm39) missense probably benign
R5651:Mpp7 UTSW 18 7,355,016 (GRCm39) critical splice donor site probably null
R5787:Mpp7 UTSW 18 7,461,682 (GRCm39) missense probably benign
R6979:Mpp7 UTSW 18 7,355,049 (GRCm39) missense possibly damaging 0.64
R6984:Mpp7 UTSW 18 7,441,623 (GRCm39) missense probably damaging 1.00
R7448:Mpp7 UTSW 18 7,351,079 (GRCm39) missense probably damaging 0.98
R7517:Mpp7 UTSW 18 7,440,183 (GRCm39) nonsense probably null
R8278:Mpp7 UTSW 18 7,444,025 (GRCm39) missense probably benign
R8676:Mpp7 UTSW 18 7,440,430 (GRCm39) critical splice donor site probably null
R9206:Mpp7 UTSW 18 7,403,327 (GRCm39) missense probably benign 0.12
R9208:Mpp7 UTSW 18 7,403,327 (GRCm39) missense probably benign 0.12
R9439:Mpp7 UTSW 18 7,461,692 (GRCm39) nonsense probably null
R9790:Mpp7 UTSW 18 7,355,049 (GRCm39) missense probably benign 0.07
R9791:Mpp7 UTSW 18 7,355,049 (GRCm39) missense probably benign 0.07
X0028:Mpp7 UTSW 18 7,403,273 (GRCm39) missense probably benign 0.04
Z1177:Mpp7 UTSW 18 7,355,062 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTACGGTGTAGGGGCTCAGAAG -3'
(R):5'- AGGTCTGCCTTCCACAATCC -3'

Sequencing Primer
(F):5'- ATCTGATTTGGCTCCCTGTGAGATC -3'
(R):5'- TGCCTTCCACAATCCCACAGG -3'
Posted On 2020-09-02