Incidental Mutation 'R8374:Astn1'
ID 646563
Institutional Source Beutler Lab
Gene Symbol Astn1
Ensembl Gene ENSMUSG00000026587
Gene Name astrotactin 1
Synonyms
MMRRC Submission 067742-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.089) question?
Stock # R8374 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 158189843-158519351 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 158329803 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 219 (N219K)
Ref Sequence ENSEMBL: ENSMUSP00000142322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046110] [ENSMUST00000170718] [ENSMUST00000193042] [ENSMUST00000194369] [ENSMUST00000195311]
AlphaFold Q61137
Predicted Effect probably damaging
Transcript: ENSMUST00000046110
AA Change: N219K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000039711
Gene: ENSMUSG00000026587
AA Change: N219K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 507 1.2e1 SMART
EGF 611 652 2.29e1 SMART
EGF_like 659 708 3.57e1 SMART
MACPF 811 999 1.11e-56 SMART
FN3 1030 1142 5.75e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000170718
AA Change: N219K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000127428
Gene: ENSMUSG00000026587
AA Change: N219K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 507 1.2e1 SMART
EGF 611 652 2.29e1 SMART
EGF_like 659 708 3.57e1 SMART
Blast:MACPF 811 835 3e-7 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000193042
AA Change: N219K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142322
Gene: ENSMUSG00000026587
AA Change: N219K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 507 1.2e1 SMART
EGF 611 652 2.29e1 SMART
EGF_like 659 708 3.57e1 SMART
MACPF 811 999 1.11e-56 SMART
FN3 1030 1142 5.75e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000194369
AA Change: N219K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142017
Gene: ENSMUSG00000026587
AA Change: N219K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 499 2e-2 SMART
EGF 603 644 1.1e-1 SMART
EGF_like 651 700 1.7e-1 SMART
Blast:MACPF 803 828 2e-7 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000195311
AA Change: N219K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141518
Gene: ENSMUSG00000026587
AA Change: N219K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 499 2e-2 SMART
EGF 603 644 1.1e-1 SMART
EGF_like 651 700 1.7e-1 SMART
MACPF 803 991 6.2e-59 SMART
FN3 1022 1134 2.8e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Astrotactin is a neuronal adhesion molecule required for glial-guided migration of young postmitotic neuroblasts in cortical regions of developing brain, including cerebrum, hippocampus, cerebellum, and olfactory bulb (Fink et al., 1995).[supplied by OMIM, Jun 2009]
PHENOTYPE: Homozygous mutation of this gene results in reduced cerebellum size, abnormal Purkinje cell morphology, and reduced coordination performance on the Rotarod test. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 C T 9: 30,814,002 (GRCm39) G721E probably benign Het
Aip A T 19: 4,165,456 (GRCm39) M170K probably damaging Het
Alms1 T C 6: 85,585,973 (GRCm39) I276T probably benign Het
Arid1b C T 17: 5,392,919 (GRCm39) P2097S possibly damaging Het
Cbx2 G T 11: 118,918,969 (GRCm39) R178L probably damaging Het
Clptm1 G A 7: 19,372,081 (GRCm39) P252S probably benign Het
Crebbp A G 16: 3,902,175 (GRCm39) S2355P probably damaging Het
D130043K22Rik C A 13: 25,041,962 (GRCm39) T297K probably benign Het
Ddx60 A G 8: 62,427,205 (GRCm39) D760G probably benign Het
Dgka T C 10: 128,557,112 (GRCm39) N621S probably benign Het
Ear10 A T 14: 44,160,645 (GRCm39) C61S probably damaging Het
F12 A T 13: 55,569,144 (GRCm39) C238S probably damaging Het
Fen1 A G 19: 10,177,824 (GRCm39) F207L probably benign Het
Fzr1 A G 10: 81,203,368 (GRCm39) L486P probably damaging Het
Gdnf A G 15: 7,864,176 (GRCm39) R196G probably benign Het
Gldc A C 19: 30,114,594 (GRCm39) F439V probably damaging Het
Gm3138 T C 14: 4,251,688 (GRCm38) M120T probably damaging Het
Gpi1 G A 7: 33,920,082 (GRCm39) A197V probably benign Het
Ighv1-4 T A 12: 114,450,899 (GRCm39) I70F probably benign Het
Il19 A T 1: 130,866,893 (GRCm39) L29Q probably damaging Het
Kank1 A T 19: 25,389,005 (GRCm39) I893F probably damaging Het
Kcnq5 G A 1: 21,549,648 (GRCm39) R360C probably damaging Het
Kif13b T C 14: 65,025,884 (GRCm39) S1414P probably damaging Het
Miga2 AAGAG AAG 2: 30,265,755 (GRCm39) probably null Het
Mosmo T A 7: 120,329,715 (GRCm39) M112K probably benign Het
Ntmt2 A T 1: 163,530,617 (GRCm39) M274K probably damaging Het
Or2d2b A G 7: 106,706,033 (GRCm39) F12L probably damaging Het
Or2h1b C A 17: 37,462,636 (GRCm39) V76F probably damaging Het
Or2w3b T A 11: 58,623,724 (GRCm39) D89V probably damaging Het
Pak6 G A 2: 118,524,477 (GRCm39) V497I probably benign Het
Ppargc1b G A 18: 61,443,564 (GRCm39) S549F probably damaging Het
Rassf8 T A 6: 145,760,863 (GRCm39) L63* probably null Het
Rptn G T 3: 93,303,602 (GRCm39) G312* probably null Het
Rsph14 T C 10: 74,797,481 (GRCm39) I169V probably benign Het
Sltm A G 9: 70,469,227 (GRCm39) D162G probably null Het
Tatdn1 C T 15: 58,788,000 (GRCm39) probably null Het
Tbx4 A C 11: 85,805,102 (GRCm39) E397A probably benign Het
Tdrd12 T C 7: 35,177,486 (GRCm39) D956G unknown Het
Tnr G A 1: 159,685,953 (GRCm39) V395I probably benign Het
Ugt1a2 A T 1: 88,129,107 (GRCm39) H250L possibly damaging Het
Vmn1r173 C T 7: 23,401,920 (GRCm39) H52Y probably damaging Het
Vps11 T C 9: 44,267,706 (GRCm39) D302G probably benign Het
Zfp398 T C 6: 47,836,468 (GRCm39) probably null Het
Other mutations in Astn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Astn1 APN 1 158,427,889 (GRCm39) missense possibly damaging 0.71
IGL01705:Astn1 APN 1 158,331,883 (GRCm39) missense probably damaging 1.00
IGL01790:Astn1 APN 1 158,407,897 (GRCm39) missense possibly damaging 0.70
IGL01962:Astn1 APN 1 158,496,201 (GRCm39) missense probably damaging 1.00
IGL02000:Astn1 APN 1 158,502,184 (GRCm39) missense probably damaging 1.00
IGL02119:Astn1 APN 1 158,338,724 (GRCm39) intron probably benign
IGL02168:Astn1 APN 1 158,436,911 (GRCm39) missense possibly damaging 0.93
IGL02239:Astn1 APN 1 158,491,700 (GRCm39) critical splice donor site probably null
IGL02271:Astn1 APN 1 158,338,520 (GRCm39) splice site probably benign
IGL02307:Astn1 APN 1 158,502,184 (GRCm39) missense probably damaging 1.00
IGL02504:Astn1 APN 1 158,329,978 (GRCm39) missense probably damaging 1.00
IGL02552:Astn1 APN 1 158,332,965 (GRCm39) missense possibly damaging 0.90
IGL02903:Astn1 APN 1 158,516,120 (GRCm39) missense probably damaging 0.99
IGL03003:Astn1 APN 1 158,439,965 (GRCm39) missense probably benign 0.00
IGL03007:Astn1 APN 1 158,496,193 (GRCm39) splice site probably benign
IGL03354:Astn1 APN 1 158,516,174 (GRCm39) missense probably damaging 1.00
PIT4366001:Astn1 UTSW 1 158,424,781 (GRCm39) missense probably benign 0.23
PIT4366001:Astn1 UTSW 1 158,424,779 (GRCm39) missense probably benign 0.20
R0024:Astn1 UTSW 1 158,511,785 (GRCm39) missense probably damaging 0.99
R0050:Astn1 UTSW 1 158,407,294 (GRCm39) splice site probably benign
R0099:Astn1 UTSW 1 158,329,721 (GRCm39) missense probably damaging 1.00
R0109:Astn1 UTSW 1 158,491,674 (GRCm39) missense possibly damaging 0.79
R0109:Astn1 UTSW 1 158,491,674 (GRCm39) missense possibly damaging 0.79
R0365:Astn1 UTSW 1 158,516,118 (GRCm39) missense probably damaging 1.00
R0416:Astn1 UTSW 1 158,337,461 (GRCm39) missense probably damaging 1.00
R0531:Astn1 UTSW 1 158,427,959 (GRCm39) missense probably damaging 0.99
R0735:Astn1 UTSW 1 158,299,959 (GRCm39) missense possibly damaging 0.53
R0763:Astn1 UTSW 1 158,337,460 (GRCm39) missense possibly damaging 0.93
R0899:Astn1 UTSW 1 158,338,679 (GRCm39) nonsense probably null
R1027:Astn1 UTSW 1 158,407,849 (GRCm39) missense probably damaging 1.00
R1160:Astn1 UTSW 1 158,427,935 (GRCm39) missense possibly damaging 0.83
R1474:Astn1 UTSW 1 158,329,923 (GRCm39) missense probably damaging 1.00
R1517:Astn1 UTSW 1 158,407,146 (GRCm39) splice site probably benign
R1701:Astn1 UTSW 1 158,331,877 (GRCm39) missense possibly damaging 0.54
R1764:Astn1 UTSW 1 158,331,821 (GRCm39) missense probably benign 0.35
R1860:Astn1 UTSW 1 158,429,515 (GRCm39) missense probably damaging 1.00
R1889:Astn1 UTSW 1 158,332,886 (GRCm39) splice site probably null
R1919:Astn1 UTSW 1 158,337,541 (GRCm39) missense probably damaging 1.00
R2001:Astn1 UTSW 1 158,348,091 (GRCm39) missense probably damaging 1.00
R2007:Astn1 UTSW 1 158,436,875 (GRCm39) missense probably damaging 0.97
R2038:Astn1 UTSW 1 158,484,690 (GRCm39) missense probably benign 0.29
R2044:Astn1 UTSW 1 158,428,072 (GRCm39) missense possibly damaging 0.53
R2084:Astn1 UTSW 1 158,299,978 (GRCm39) missense probably damaging 0.99
R2094:Astn1 UTSW 1 158,495,179 (GRCm39) missense probably benign 0.02
R2163:Astn1 UTSW 1 158,329,720 (GRCm39) missense probably damaging 0.99
R2211:Astn1 UTSW 1 158,484,876 (GRCm39) missense probably benign 0.40
R2268:Astn1 UTSW 1 158,329,669 (GRCm39) missense probably damaging 1.00
R2269:Astn1 UTSW 1 158,329,669 (GRCm39) missense probably damaging 1.00
R2425:Astn1 UTSW 1 158,407,236 (GRCm39) missense probably damaging 0.99
R2428:Astn1 UTSW 1 158,439,916 (GRCm39) missense possibly damaging 0.66
R2980:Astn1 UTSW 1 158,400,521 (GRCm39) critical splice acceptor site probably null
R3713:Astn1 UTSW 1 158,495,102 (GRCm39) missense possibly damaging 0.83
R3745:Astn1 UTSW 1 158,329,630 (GRCm39) missense probably damaging 1.00
R3926:Astn1 UTSW 1 158,407,227 (GRCm39) missense possibly damaging 0.95
R4345:Astn1 UTSW 1 158,329,602 (GRCm39) splice site probably null
R4625:Astn1 UTSW 1 158,407,864 (GRCm39) missense probably damaging 1.00
R4627:Astn1 UTSW 1 158,329,821 (GRCm39) missense possibly damaging 0.55
R4970:Astn1 UTSW 1 158,484,763 (GRCm39) missense possibly damaging 0.88
R5112:Astn1 UTSW 1 158,484,763 (GRCm39) missense possibly damaging 0.88
R5257:Astn1 UTSW 1 158,440,102 (GRCm39) missense probably damaging 1.00
R5292:Astn1 UTSW 1 158,407,933 (GRCm39) critical splice donor site probably null
R5889:Astn1 UTSW 1 158,427,950 (GRCm39) missense possibly damaging 0.93
R5909:Astn1 UTSW 1 158,429,507 (GRCm39) missense probably damaging 1.00
R6020:Astn1 UTSW 1 158,337,563 (GRCm39) missense probably damaging 1.00
R6349:Astn1 UTSW 1 158,491,691 (GRCm39) nonsense probably null
R6481:Astn1 UTSW 1 158,440,032 (GRCm39) missense probably benign 0.29
R6736:Astn1 UTSW 1 158,338,718 (GRCm39) critical splice donor site probably null
R6833:Astn1 UTSW 1 158,491,692 (GRCm39) missense probably benign 0.40
R6834:Astn1 UTSW 1 158,491,692 (GRCm39) missense probably benign 0.40
R6860:Astn1 UTSW 1 158,440,042 (GRCm39) missense probably damaging 1.00
R6874:Astn1 UTSW 1 158,491,644 (GRCm39) nonsense probably null
R7062:Astn1 UTSW 1 158,516,081 (GRCm39) critical splice acceptor site probably null
R7133:Astn1 UTSW 1 158,400,557 (GRCm39) missense probably damaging 1.00
R7355:Astn1 UTSW 1 158,491,846 (GRCm39) splice site probably null
R7402:Astn1 UTSW 1 158,380,425 (GRCm39) intron probably benign
R7412:Astn1 UTSW 1 158,329,919 (GRCm39) missense probably damaging 0.98
R7487:Astn1 UTSW 1 158,438,352 (GRCm39) splice site probably null
R7537:Astn1 UTSW 1 158,495,208 (GRCm39) splice site probably null
R7537:Astn1 UTSW 1 158,332,956 (GRCm39) missense possibly damaging 0.84
R7635:Astn1 UTSW 1 158,495,105 (GRCm39) nonsense probably null
R7890:Astn1 UTSW 1 158,407,903 (GRCm39) missense probably damaging 1.00
R7894:Astn1 UTSW 1 158,429,508 (GRCm39) missense probably damaging 0.98
R7904:Astn1 UTSW 1 158,424,886 (GRCm39) missense probably benign 0.37
R8048:Astn1 UTSW 1 158,516,208 (GRCm39) missense probably benign 0.00
R8061:Astn1 UTSW 1 158,331,920 (GRCm39) critical splice donor site probably null
R8096:Astn1 UTSW 1 158,436,890 (GRCm39) missense probably damaging 1.00
R8327:Astn1 UTSW 1 158,436,850 (GRCm39) missense probably damaging 1.00
R8400:Astn1 UTSW 1 158,484,670 (GRCm39) missense probably benign 0.09
R8983:Astn1 UTSW 1 158,491,700 (GRCm39) critical splice donor site probably null
R9013:Astn1 UTSW 1 158,348,070 (GRCm39) missense probably damaging 1.00
R9110:Astn1 UTSW 1 158,496,327 (GRCm39) missense probably benign 0.01
R9156:Astn1 UTSW 1 158,338,555 (GRCm39) missense probably damaging 0.99
R9355:Astn1 UTSW 1 158,511,721 (GRCm39) missense probably damaging 1.00
R9683:Astn1 UTSW 1 158,491,619 (GRCm39) missense possibly damaging 0.93
Z1088:Astn1 UTSW 1 158,511,666 (GRCm39) nonsense probably null
Z1088:Astn1 UTSW 1 158,424,776 (GRCm39) missense possibly damaging 0.91
Z1088:Astn1 UTSW 1 158,300,067 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CTTTCCAGGGTGGCATGATC -3'
(R):5'- CTGGTGTTAGATCCATCCCAGAC -3'

Sequencing Primer
(F):5'- GGCATGATCGCTCTGTTGCTATC -3'
(R):5'- AGACTTCTCATTGCATCCCTGTAGG -3'
Posted On 2020-09-02