Incidental Mutation 'R8374:Rassf8'
ID646571
Institutional Source Beutler Lab
Gene Symbol Rassf8
Ensembl Gene ENSMUSG00000030259
Gene NameRas association (RalGDS/AF-6) domain family (N-terminal) member 8
Synonyms5133400D11Rik, mHoj-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.774) question?
Stock #R8374 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location145746748-145821079 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 145815137 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 63 (L63*)
Ref Sequence ENSEMBL: ENSMUSP00000032388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032388] [ENSMUST00000058538] [ENSMUST00000111704] [ENSMUST00000140966]
Predicted Effect probably null
Transcript: ENSMUST00000032388
AA Change: L63*
SMART Domains Protein: ENSMUSP00000032388
Gene: ENSMUSG00000030259
AA Change: L63*

DomainStartEndE-ValueType
RA 1 82 4.17e-11 SMART
coiled coil region 161 354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058538
Predicted Effect probably null
Transcript: ENSMUST00000111704
AA Change: L63*
SMART Domains Protein: ENSMUSP00000107333
Gene: ENSMUSG00000030259
AA Change: L63*

DomainStartEndE-ValueType
RA 1 82 4.17e-11 SMART
coiled coil region 161 354 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000140966
AA Change: L63*
SMART Domains Protein: ENSMUSP00000122684
Gene: ENSMUSG00000030259
AA Change: L63*

DomainStartEndE-ValueType
RA 1 80 7.85e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-assocation domain family (RASSF) of tumor suppressor proteins. This gene is essential for maintaining adherens junction function in epithelial cells and has a role in epithelial cell migration. It is a lung tumor suppressor gene candidate. A chromosomal translocation t(12;22)(p11.2;q13.3) leading to the fusion of this gene and the FBLN1 gene is found in a complex type of synpolydactyly. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 C T 9: 30,902,706 G721E probably benign Het
Aip A T 19: 4,115,456 M170K probably damaging Het
Alms1 T C 6: 85,608,991 I276T probably benign Het
Arid1b C T 17: 5,342,644 P2097S possibly damaging Het
Astn1 T G 1: 158,502,233 N219K probably damaging Het
Cbx2 G T 11: 119,028,143 R178L probably damaging Het
Clptm1 G A 7: 19,638,156 P252S probably benign Het
Crebbp A G 16: 4,084,311 S2355P probably damaging Het
D130043K22Rik C A 13: 24,857,979 T297K probably benign Het
Ddx60 A G 8: 61,974,171 D760G probably benign Het
Dgka T C 10: 128,721,243 N621S probably benign Het
Ear10 A T 14: 43,923,188 C61S probably damaging Het
F12 A T 13: 55,421,331 C238S probably damaging Het
Fen1 A G 19: 10,200,460 F207L probably benign Het
Fzr1 A G 10: 81,367,534 L486P probably damaging Het
Gdnf A G 15: 7,834,695 R196G probably benign Het
Gldc A C 19: 30,137,194 F439V probably damaging Het
Gm3138 T C 14: 4,251,688 M120T probably damaging Het
Gpi1 G A 7: 34,220,657 A197V probably benign Het
Ighv1-4 T A 12: 114,487,279 I70F probably benign Het
Il19 A T 1: 130,939,156 L29Q probably damaging Het
Kank1 A T 19: 25,411,641 I893F probably damaging Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Kif13b T C 14: 64,788,435 S1414P probably damaging Het
Mettl11b A T 1: 163,703,048 M274K probably damaging Het
Miga2 AAGAG AAG 2: 30,375,743 probably null Het
Mosmo T A 7: 120,730,492 M112K probably benign Het
Olfr317 T A 11: 58,732,898 D89V probably damaging Het
Olfr715b A G 7: 107,106,826 F12L probably damaging Het
Olfr93 C A 17: 37,151,745 V76F probably damaging Het
Pak6 G A 2: 118,693,996 V497I probably benign Het
Ppargc1b G A 18: 61,310,493 S549F probably damaging Het
Rptn G T 3: 93,396,295 G312* probably null Het
Rsph14 T C 10: 74,961,649 I169V probably benign Het
Sltm A G 9: 70,561,945 D162G probably null Het
Tatdn1 C T 15: 58,916,151 probably null Het
Tbx4 A C 11: 85,914,276 E397A probably benign Het
Tdrd12 T C 7: 35,478,061 D956G unknown Het
Tnr G A 1: 159,858,383 V395I probably benign Het
Ugt1a2 A T 1: 88,201,385 H250L possibly damaging Het
Vmn1r173 C T 7: 23,702,495 H52Y probably damaging Het
Vps11 T C 9: 44,356,409 D302G probably benign Het
Zfp398 T C 6: 47,859,534 probably null Het
Other mutations in Rassf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02973:Rassf8 APN 6 145817190 unclassified probably benign
IGL03017:Rassf8 APN 6 145817198 splice site probably null
IGL03091:Rassf8 APN 6 145815810 missense probably benign 0.00
R0230:Rassf8 UTSW 6 145819974 unclassified probably benign
R0967:Rassf8 UTSW 6 145819950 unclassified probably benign
R1429:Rassf8 UTSW 6 145815190 missense probably damaging 1.00
R1622:Rassf8 UTSW 6 145820103 unclassified probably benign
R1738:Rassf8 UTSW 6 145815308 missense probably benign 0.03
R1894:Rassf8 UTSW 6 145808473 missense probably damaging 1.00
R2126:Rassf8 UTSW 6 145815182 missense probably benign 0.00
R2238:Rassf8 UTSW 6 145817184 missense probably damaging 1.00
R2439:Rassf8 UTSW 6 145815334 missense probably damaging 1.00
R3699:Rassf8 UTSW 6 145820076 unclassified probably benign
R4678:Rassf8 UTSW 6 145815082 missense probably damaging 1.00
R4734:Rassf8 UTSW 6 145815540 missense probably benign 0.34
R4826:Rassf8 UTSW 6 145816550 missense probably damaging 1.00
R4910:Rassf8 UTSW 6 145815280 nonsense probably null
R4988:Rassf8 UTSW 6 145817144 missense possibly damaging 0.89
R5425:Rassf8 UTSW 6 145815542 missense probably benign
R5620:Rassf8 UTSW 6 145820181 unclassified probably benign
R5747:Rassf8 UTSW 6 145815815 missense probably benign 0.00
R6136:Rassf8 UTSW 6 145815656 missense probably benign 0.00
R6220:Rassf8 UTSW 6 145817133 missense probably damaging 1.00
R7274:Rassf8 UTSW 6 145815569 missense probably benign 0.03
R7315:Rassf8 UTSW 6 145815751 missense probably benign
R7480:Rassf8 UTSW 6 145820031 missense unknown
R7593:Rassf8 UTSW 6 145815403 missense probably benign 0.08
R7714:Rassf8 UTSW 6 145815247 missense probably damaging 0.98
R7962:Rassf8 UTSW 6 145815943 critical splice donor site probably null
R8222:Rassf8 UTSW 6 145820057 missense unknown
R8409:Rassf8 UTSW 6 145815703 missense probably benign
Z1088:Rassf8 UTSW 6 145815482 missense probably benign
Z1088:Rassf8 UTSW 6 145816616 missense probably benign 0.41
Z1176:Rassf8 UTSW 6 145816642 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACTGGTGGACATTCTGATGC -3'
(R):5'- GTGAGAGACTTTCGCTTAGGC -3'

Sequencing Primer
(F):5'- GGACATTCTGATGCTAACTGAGAAC -3'
(R):5'- AGGCTCCCTCCTTCTGATGG -3'
Posted On2020-09-02