Incidental Mutation 'R8374:Ddx60'
ID 646578
Institutional Source Beutler Lab
Gene Symbol Ddx60
Ensembl Gene ENSMUSG00000037921
Gene Name DExD/H box helicase 60
Synonyms DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
MMRRC Submission 067742-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.199) question?
Stock # R8374 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 62381121-62490735 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 62427205 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 760 (D760G)
Ref Sequence ENSEMBL: ENSMUSP00000091197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485]
AlphaFold E9PZQ1
Predicted Effect probably benign
Transcript: ENSMUST00000070631
AA Change: D759G

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921
AA Change: D759G

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 758 949 1.05e-15 SMART
Blast:DEXDc 1007 1132 4e-24 BLAST
HELICc 1245 1328 4.35e-13 SMART
low complexity region 1362 1373 N/A INTRINSIC
Blast:DEXDc 1503 1584 1e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000093485
AA Change: D760G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921
AA Change: D760G

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 759 950 1.05e-15 SMART
Blast:DEXDc 1008 1133 4e-24 BLAST
HELICc 1246 1329 4.35e-13 SMART
low complexity region 1363 1374 N/A INTRINSIC
Blast:DEXDc 1504 1585 1e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 C T 9: 30,814,002 (GRCm39) G721E probably benign Het
Aip A T 19: 4,165,456 (GRCm39) M170K probably damaging Het
Alms1 T C 6: 85,585,973 (GRCm39) I276T probably benign Het
Arid1b C T 17: 5,392,919 (GRCm39) P2097S possibly damaging Het
Astn1 T G 1: 158,329,803 (GRCm39) N219K probably damaging Het
Cbx2 G T 11: 118,918,969 (GRCm39) R178L probably damaging Het
Clptm1 G A 7: 19,372,081 (GRCm39) P252S probably benign Het
Crebbp A G 16: 3,902,175 (GRCm39) S2355P probably damaging Het
D130043K22Rik C A 13: 25,041,962 (GRCm39) T297K probably benign Het
Dgka T C 10: 128,557,112 (GRCm39) N621S probably benign Het
Ear10 A T 14: 44,160,645 (GRCm39) C61S probably damaging Het
F12 A T 13: 55,569,144 (GRCm39) C238S probably damaging Het
Fen1 A G 19: 10,177,824 (GRCm39) F207L probably benign Het
Fzr1 A G 10: 81,203,368 (GRCm39) L486P probably damaging Het
Gdnf A G 15: 7,864,176 (GRCm39) R196G probably benign Het
Gldc A C 19: 30,114,594 (GRCm39) F439V probably damaging Het
Gm3138 T C 14: 4,251,688 (GRCm38) M120T probably damaging Het
Gpi1 G A 7: 33,920,082 (GRCm39) A197V probably benign Het
Ighv1-4 T A 12: 114,450,899 (GRCm39) I70F probably benign Het
Il19 A T 1: 130,866,893 (GRCm39) L29Q probably damaging Het
Kank1 A T 19: 25,389,005 (GRCm39) I893F probably damaging Het
Kcnq5 G A 1: 21,549,648 (GRCm39) R360C probably damaging Het
Kif13b T C 14: 65,025,884 (GRCm39) S1414P probably damaging Het
Miga2 AAGAG AAG 2: 30,265,755 (GRCm39) probably null Het
Mosmo T A 7: 120,329,715 (GRCm39) M112K probably benign Het
Ntmt2 A T 1: 163,530,617 (GRCm39) M274K probably damaging Het
Or2d2b A G 7: 106,706,033 (GRCm39) F12L probably damaging Het
Or2h1b C A 17: 37,462,636 (GRCm39) V76F probably damaging Het
Or2w3b T A 11: 58,623,724 (GRCm39) D89V probably damaging Het
Pak6 G A 2: 118,524,477 (GRCm39) V497I probably benign Het
Ppargc1b G A 18: 61,443,564 (GRCm39) S549F probably damaging Het
Rassf8 T A 6: 145,760,863 (GRCm39) L63* probably null Het
Rptn G T 3: 93,303,602 (GRCm39) G312* probably null Het
Rsph14 T C 10: 74,797,481 (GRCm39) I169V probably benign Het
Sltm A G 9: 70,469,227 (GRCm39) D162G probably null Het
Tatdn1 C T 15: 58,788,000 (GRCm39) probably null Het
Tbx4 A C 11: 85,805,102 (GRCm39) E397A probably benign Het
Tdrd12 T C 7: 35,177,486 (GRCm39) D956G unknown Het
Tnr G A 1: 159,685,953 (GRCm39) V395I probably benign Het
Ugt1a2 A T 1: 88,129,107 (GRCm39) H250L possibly damaging Het
Vmn1r173 C T 7: 23,401,920 (GRCm39) H52Y probably damaging Het
Vps11 T C 9: 44,267,706 (GRCm39) D302G probably benign Het
Zfp398 T C 6: 47,836,468 (GRCm39) probably null Het
Other mutations in Ddx60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ddx60 APN 8 62,411,680 (GRCm39) missense probably damaging 1.00
IGL00915:Ddx60 APN 8 62,440,465 (GRCm39) missense possibly damaging 0.79
IGL00931:Ddx60 APN 8 62,422,617 (GRCm39) missense probably benign 0.18
IGL01023:Ddx60 APN 8 62,395,548 (GRCm39) missense probably damaging 0.99
IGL01313:Ddx60 APN 8 62,435,560 (GRCm39) missense probably damaging 1.00
IGL01615:Ddx60 APN 8 62,416,774 (GRCm39) missense probably null 0.81
IGL01733:Ddx60 APN 8 62,436,899 (GRCm39) missense probably damaging 0.99
IGL01779:Ddx60 APN 8 62,470,857 (GRCm39) missense possibly damaging 0.94
IGL01900:Ddx60 APN 8 62,453,743 (GRCm39) splice site probably benign
IGL02110:Ddx60 APN 8 62,470,281 (GRCm39) critical splice donor site probably null
IGL02302:Ddx60 APN 8 62,428,866 (GRCm39) missense possibly damaging 0.85
IGL02468:Ddx60 APN 8 62,411,676 (GRCm39) missense probably damaging 1.00
IGL02569:Ddx60 APN 8 62,477,985 (GRCm39) missense possibly damaging 0.93
IGL02622:Ddx60 APN 8 62,395,470 (GRCm39) splice site probably null
IGL02657:Ddx60 APN 8 62,437,149 (GRCm39) missense probably benign 0.01
IGL02677:Ddx60 APN 8 62,441,166 (GRCm39) missense probably damaging 1.00
IGL02701:Ddx60 APN 8 62,432,375 (GRCm39) missense probably damaging 0.96
IGL02806:Ddx60 APN 8 62,409,156 (GRCm39) missense probably benign 0.00
IGL03137:Ddx60 APN 8 62,441,117 (GRCm39) missense possibly damaging 0.61
IGL03295:Ddx60 APN 8 62,409,155 (GRCm39) missense possibly damaging 0.82
IGL03387:Ddx60 APN 8 62,465,483 (GRCm39) missense probably damaging 1.00
IGL03411:Ddx60 APN 8 62,430,916 (GRCm39) critical splice acceptor site probably null
Scatter UTSW 8 62,474,348 (GRCm39) missense possibly damaging 0.80
shotgun UTSW 8 62,490,101 (GRCm39) missense probably benign 0.28
splay UTSW 8 62,474,343 (GRCm39) missense possibly damaging 0.80
G1Funyon:Ddx60 UTSW 8 62,453,631 (GRCm39) missense probably benign 0.01
PIT4504001:Ddx60 UTSW 8 62,411,147 (GRCm39) missense probably benign
PIT4677001:Ddx60 UTSW 8 62,425,288 (GRCm39) missense possibly damaging 0.87
R0090:Ddx60 UTSW 8 62,395,327 (GRCm39) missense probably damaging 1.00
R0266:Ddx60 UTSW 8 62,486,527 (GRCm39) missense possibly damaging 0.92
R0325:Ddx60 UTSW 8 62,436,889 (GRCm39) missense probably benign 0.00
R0367:Ddx60 UTSW 8 62,470,783 (GRCm39) missense possibly damaging 0.78
R0403:Ddx60 UTSW 8 62,447,575 (GRCm39) splice site probably benign
R0479:Ddx60 UTSW 8 62,422,691 (GRCm39) missense probably damaging 1.00
R0561:Ddx60 UTSW 8 62,470,828 (GRCm39) missense possibly damaging 0.93
R0844:Ddx60 UTSW 8 62,440,395 (GRCm39) missense probably benign 0.27
R1119:Ddx60 UTSW 8 62,395,578 (GRCm39) missense probably damaging 1.00
R1428:Ddx60 UTSW 8 62,411,193 (GRCm39) splice site probably benign
R1778:Ddx60 UTSW 8 62,427,210 (GRCm39) missense possibly damaging 0.85
R1840:Ddx60 UTSW 8 62,422,587 (GRCm39) missense probably damaging 0.99
R1964:Ddx60 UTSW 8 62,401,903 (GRCm39) missense probably benign 0.10
R1970:Ddx60 UTSW 8 62,425,240 (GRCm39) missense possibly damaging 0.93
R2101:Ddx60 UTSW 8 62,393,679 (GRCm39) missense probably damaging 1.00
R2174:Ddx60 UTSW 8 62,470,234 (GRCm39) missense probably benign 0.01
R2174:Ddx60 UTSW 8 62,409,175 (GRCm39) missense probably damaging 1.00
R2198:Ddx60 UTSW 8 62,411,097 (GRCm39) missense possibly damaging 0.79
R2332:Ddx60 UTSW 8 62,490,125 (GRCm39) missense probably benign 0.08
R2338:Ddx60 UTSW 8 62,465,470 (GRCm39) missense possibly damaging 0.91
R2379:Ddx60 UTSW 8 62,490,122 (GRCm39) missense probably damaging 1.00
R4010:Ddx60 UTSW 8 62,409,178 (GRCm39) missense probably benign 0.25
R4010:Ddx60 UTSW 8 62,407,569 (GRCm39) missense possibly damaging 0.65
R4133:Ddx60 UTSW 8 62,425,254 (GRCm39) missense probably damaging 0.99
R4282:Ddx60 UTSW 8 62,447,427 (GRCm39) missense probably damaging 0.99
R4382:Ddx60 UTSW 8 62,402,012 (GRCm39) splice site probably null
R4561:Ddx60 UTSW 8 62,395,495 (GRCm39) missense probably damaging 0.96
R4572:Ddx60 UTSW 8 62,440,455 (GRCm39) missense probably damaging 1.00
R4581:Ddx60 UTSW 8 62,476,295 (GRCm39) missense possibly damaging 0.90
R4635:Ddx60 UTSW 8 62,490,101 (GRCm39) missense probably benign 0.28
R4698:Ddx60 UTSW 8 62,465,458 (GRCm39) missense probably benign 0.01
R4807:Ddx60 UTSW 8 62,432,372 (GRCm39) missense probably damaging 1.00
R4858:Ddx60 UTSW 8 62,474,348 (GRCm39) missense possibly damaging 0.80
R4964:Ddx60 UTSW 8 62,432,372 (GRCm39) missense probably damaging 1.00
R5120:Ddx60 UTSW 8 62,398,940 (GRCm39) missense probably benign 0.01
R5187:Ddx60 UTSW 8 62,427,222 (GRCm39) missense probably damaging 1.00
R5222:Ddx60 UTSW 8 62,437,192 (GRCm39) missense probably damaging 0.99
R5400:Ddx60 UTSW 8 62,463,036 (GRCm39) missense possibly damaging 0.65
R5500:Ddx60 UTSW 8 62,403,485 (GRCm39) missense probably benign 0.28
R5514:Ddx60 UTSW 8 62,411,091 (GRCm39) missense probably damaging 1.00
R5668:Ddx60 UTSW 8 62,453,612 (GRCm39) missense probably benign 0.38
R5742:Ddx60 UTSW 8 62,401,955 (GRCm39) missense probably benign
R5772:Ddx60 UTSW 8 62,401,931 (GRCm39) missense probably damaging 1.00
R5810:Ddx60 UTSW 8 62,465,422 (GRCm39) nonsense probably null
R5815:Ddx60 UTSW 8 62,416,756 (GRCm39) missense probably damaging 0.98
R5820:Ddx60 UTSW 8 62,409,155 (GRCm39) missense possibly damaging 0.82
R5866:Ddx60 UTSW 8 62,393,774 (GRCm39) missense probably damaging 1.00
R5881:Ddx60 UTSW 8 62,490,104 (GRCm39) missense probably damaging 1.00
R5977:Ddx60 UTSW 8 62,474,444 (GRCm39) critical splice donor site probably null
R6048:Ddx60 UTSW 8 62,453,616 (GRCm39) missense probably benign 0.01
R6061:Ddx60 UTSW 8 62,476,275 (GRCm39) missense probably null 0.01
R6153:Ddx60 UTSW 8 62,398,974 (GRCm39) missense possibly damaging 0.47
R6287:Ddx60 UTSW 8 62,403,612 (GRCm39) missense probably damaging 1.00
R6415:Ddx60 UTSW 8 62,436,939 (GRCm39) missense probably benign 0.00
R6416:Ddx60 UTSW 8 62,451,715 (GRCm39) missense probably benign
R6416:Ddx60 UTSW 8 62,430,984 (GRCm39) missense probably benign 0.00
R6660:Ddx60 UTSW 8 62,409,273 (GRCm39) missense probably benign 0.00
R6694:Ddx60 UTSW 8 62,490,104 (GRCm39) missense probably damaging 1.00
R6715:Ddx60 UTSW 8 62,436,924 (GRCm39) missense probably benign 0.03
R6720:Ddx60 UTSW 8 62,453,723 (GRCm39) missense probably benign 0.10
R6937:Ddx60 UTSW 8 62,490,103 (GRCm39) missense probably damaging 1.00
R7153:Ddx60 UTSW 8 62,441,142 (GRCm39) missense possibly damaging 0.71
R7274:Ddx60 UTSW 8 62,393,142 (GRCm39) critical splice donor site probably null
R7409:Ddx60 UTSW 8 62,411,612 (GRCm39) missense probably benign 0.24
R7464:Ddx60 UTSW 8 62,393,708 (GRCm39) missense possibly damaging 0.82
R7670:Ddx60 UTSW 8 62,428,826 (GRCm39) missense probably damaging 1.00
R7904:Ddx60 UTSW 8 62,430,924 (GRCm39) missense possibly damaging 0.81
R7992:Ddx60 UTSW 8 62,407,569 (GRCm39) missense probably benign 0.03
R8124:Ddx60 UTSW 8 62,436,945 (GRCm39) missense probably benign
R8125:Ddx60 UTSW 8 62,436,945 (GRCm39) missense probably benign
R8126:Ddx60 UTSW 8 62,436,945 (GRCm39) missense probably benign
R8155:Ddx60 UTSW 8 62,470,205 (GRCm39) missense possibly damaging 0.61
R8174:Ddx60 UTSW 8 62,470,284 (GRCm39) splice site probably null
R8192:Ddx60 UTSW 8 62,431,002 (GRCm39) missense probably damaging 1.00
R8271:Ddx60 UTSW 8 62,393,142 (GRCm39) critical splice donor site probably null
R8301:Ddx60 UTSW 8 62,453,631 (GRCm39) missense probably benign 0.01
R8304:Ddx60 UTSW 8 62,451,803 (GRCm39) missense possibly damaging 0.67
R8319:Ddx60 UTSW 8 62,395,669 (GRCm39) critical splice donor site probably null
R8401:Ddx60 UTSW 8 62,409,277 (GRCm39) missense possibly damaging 0.57
R8487:Ddx60 UTSW 8 62,427,184 (GRCm39) missense probably damaging 1.00
R8804:Ddx60 UTSW 8 62,411,640 (GRCm39) missense probably benign 0.27
R8826:Ddx60 UTSW 8 62,398,990 (GRCm39) missense probably benign 0.02
R8829:Ddx60 UTSW 8 62,393,695 (GRCm39) missense probably damaging 1.00
R8881:Ddx60 UTSW 8 62,474,343 (GRCm39) missense possibly damaging 0.80
R8884:Ddx60 UTSW 8 62,447,553 (GRCm39) missense possibly damaging 0.86
R8990:Ddx60 UTSW 8 62,427,168 (GRCm39) nonsense probably null
R9122:Ddx60 UTSW 8 62,442,898 (GRCm39) missense probably benign 0.16
R9225:Ddx60 UTSW 8 62,470,875 (GRCm39) missense probably benign 0.36
R9278:Ddx60 UTSW 8 62,431,012 (GRCm39) missense possibly damaging 0.83
R9293:Ddx60 UTSW 8 62,462,994 (GRCm39) missense possibly damaging 0.89
R9405:Ddx60 UTSW 8 62,425,248 (GRCm39) missense probably benign 0.03
R9766:Ddx60 UTSW 8 62,465,312 (GRCm39) missense probably damaging 1.00
X0003:Ddx60 UTSW 8 62,486,451 (GRCm39) missense possibly damaging 0.88
X0019:Ddx60 UTSW 8 62,416,726 (GRCm39) missense probably benign 0.01
Z1177:Ddx60 UTSW 8 62,453,622 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GAAAAGTGGTAAGGTCTTCATGATG -3'
(R):5'- TGGATTCATTCAACACCTCACCAAG -3'

Sequencing Primer
(F):5'- TAGGATGCATCAGATGGC -3'
(R):5'- AGGAGACCTTTTAAACAGCAAAG -3'
Posted On 2020-09-02