Incidental Mutation 'R8374:Sltm'
ID646581
Institutional Source Beutler Lab
Gene Symbol Sltm
Ensembl Gene ENSMUSG00000032212
Gene NameSAFB-like, transcription modulator
Synonyms9130215G10Rik, 5730555F13Rik, 5730455C01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R8374 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location70542754-70592234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70561945 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 162 (D162G)
Ref Sequence ENSEMBL: ENSMUSP00000049112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049263] [ENSMUST00000213808] [ENSMUST00000216816] [ENSMUST00000217593]
Predicted Effect probably null
Transcript: ENSMUST00000049263
AA Change: D162G
SMART Domains Protein: ENSMUSP00000049112
Gene: ENSMUSG00000032212
AA Change: D162G

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SAP 22 56 2.49e-10 SMART
low complexity region 74 86 N/A INTRINSIC
coiled coil region 152 180 N/A INTRINSIC
low complexity region 318 330 N/A INTRINSIC
low complexity region 352 384 N/A INTRINSIC
RRM 385 458 2.06e-16 SMART
low complexity region 498 526 N/A INTRINSIC
low complexity region 536 552 N/A INTRINSIC
low complexity region 591 601 N/A INTRINSIC
coiled coil region 635 727 N/A INTRINSIC
low complexity region 824 853 N/A INTRINSIC
low complexity region 979 990 N/A INTRINSIC
low complexity region 1015 1028 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213808
Predicted Effect probably null
Transcript: ENSMUST00000216816
AA Change: D162G
Predicted Effect probably benign
Transcript: ENSMUST00000217593
AA Change: D162G

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 C T 9: 30,902,706 G721E probably benign Het
Aip A T 19: 4,115,456 M170K probably damaging Het
Alms1 T C 6: 85,608,991 I276T probably benign Het
Arid1b C T 17: 5,342,644 P2097S possibly damaging Het
Astn1 T G 1: 158,502,233 N219K probably damaging Het
Cbx2 G T 11: 119,028,143 R178L probably damaging Het
Clptm1 G A 7: 19,638,156 P252S probably benign Het
Crebbp A G 16: 4,084,311 S2355P probably damaging Het
D130043K22Rik C A 13: 24,857,979 T297K probably benign Het
Ddx60 A G 8: 61,974,171 D760G probably benign Het
Dgka T C 10: 128,721,243 N621S probably benign Het
Ear10 A T 14: 43,923,188 C61S probably damaging Het
F12 A T 13: 55,421,331 C238S probably damaging Het
Fen1 A G 19: 10,200,460 F207L probably benign Het
Fzr1 A G 10: 81,367,534 L486P probably damaging Het
Gdnf A G 15: 7,834,695 R196G probably benign Het
Gldc A C 19: 30,137,194 F439V probably damaging Het
Gm3138 T C 14: 4,251,688 M120T probably damaging Het
Gpi1 G A 7: 34,220,657 A197V probably benign Het
Ighv1-4 T A 12: 114,487,279 I70F probably benign Het
Il19 A T 1: 130,939,156 L29Q probably damaging Het
Kank1 A T 19: 25,411,641 I893F probably damaging Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Kif13b T C 14: 64,788,435 S1414P probably damaging Het
Mettl11b A T 1: 163,703,048 M274K probably damaging Het
Miga2 AAGAG AAG 2: 30,375,743 probably null Het
Mosmo T A 7: 120,730,492 M112K probably benign Het
Olfr317 T A 11: 58,732,898 D89V probably damaging Het
Olfr715b A G 7: 107,106,826 F12L probably damaging Het
Olfr93 C A 17: 37,151,745 V76F probably damaging Het
Pak6 G A 2: 118,693,996 V497I probably benign Het
Ppargc1b G A 18: 61,310,493 S549F probably damaging Het
Rassf8 T A 6: 145,815,137 L63* probably null Het
Rptn G T 3: 93,396,295 G312* probably null Het
Rsph14 T C 10: 74,961,649 I169V probably benign Het
Tatdn1 C T 15: 58,916,151 probably null Het
Tbx4 A C 11: 85,914,276 E397A probably benign Het
Tdrd12 T C 7: 35,478,061 D956G unknown Het
Tnr G A 1: 159,858,383 V395I probably benign Het
Ugt1a2 A T 1: 88,201,385 H250L possibly damaging Het
Vmn1r173 C T 7: 23,702,495 H52Y probably damaging Het
Vps11 T C 9: 44,356,409 D302G probably benign Het
Zfp398 T C 6: 47,859,534 probably null Het
Other mutations in Sltm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Sltm APN 9 70579342 missense probably damaging 1.00
IGL01755:Sltm APN 9 70583922 splice site probably null
IGL01782:Sltm APN 9 70573641 missense probably damaging 1.00
IGL02441:Sltm APN 9 70587185 missense probably damaging 1.00
IGL02831:Sltm APN 9 70584865 missense probably damaging 1.00
IGL02947:Sltm APN 9 70591664 missense probably benign 0.05
IGL03166:Sltm APN 9 70542969 missense possibly damaging 0.87
R0288:Sltm UTSW 9 70579351 missense probably damaging 1.00
R0555:Sltm UTSW 9 70586081 missense probably damaging 1.00
R0815:Sltm UTSW 9 70561908 missense probably benign 0.04
R0863:Sltm UTSW 9 70561908 missense probably benign 0.04
R1315:Sltm UTSW 9 70543065 missense probably benign 0.13
R1533:Sltm UTSW 9 70586666 missense probably damaging 1.00
R1676:Sltm UTSW 9 70573647 missense probably damaging 1.00
R1764:Sltm UTSW 9 70561800 missense probably benign 0.00
R1845:Sltm UTSW 9 70543032 missense possibly damaging 0.60
R2049:Sltm UTSW 9 70581301 missense probably benign 0.00
R2163:Sltm UTSW 9 70591682 missense probably damaging 0.99
R3410:Sltm UTSW 9 70585958 missense probably damaging 0.97
R4323:Sltm UTSW 9 70580247 missense probably benign
R4632:Sltm UTSW 9 70579369 missense possibly damaging 0.86
R4748:Sltm UTSW 9 70581365 missense probably damaging 1.00
R4756:Sltm UTSW 9 70591610 missense possibly damaging 0.57
R4782:Sltm UTSW 9 70589057 missense probably damaging 1.00
R4799:Sltm UTSW 9 70589057 missense probably damaging 1.00
R4887:Sltm UTSW 9 70588978 missense probably damaging 1.00
R5221:Sltm UTSW 9 70579403 missense probably damaging 1.00
R5263:Sltm UTSW 9 70584799 missense unknown
R5982:Sltm UTSW 9 70586804 missense probably damaging 1.00
R6297:Sltm UTSW 9 70581359 missense probably damaging 0.99
R6456:Sltm UTSW 9 70542987 missense probably damaging 1.00
R6658:Sltm UTSW 9 70581362 missense probably damaging 1.00
R6720:Sltm UTSW 9 70573710 missense probably damaging 1.00
R6770:Sltm UTSW 9 70584777 missense unknown
R6923:Sltm UTSW 9 70574610 missense probably damaging 1.00
R7051:Sltm UTSW 9 70559066 missense probably damaging 1.00
R7166:Sltm UTSW 9 70584850 missense probably damaging 1.00
R7257:Sltm UTSW 9 70543965 splice site probably null
R7400:Sltm UTSW 9 70586070 missense probably damaging 1.00
R7438:Sltm UTSW 9 70573466 missense unknown
R7484:Sltm UTSW 9 70573897 missense unknown
R7630:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7631:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7632:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7633:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7862:Sltm UTSW 9 70572164 nonsense probably null
R7885:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7886:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7888:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7889:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7891:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7915:Sltm UTSW 9 70587149 missense probably damaging 1.00
R8030:Sltm UTSW 9 70585979 nonsense probably null
R8062:Sltm UTSW 9 70573497 missense unknown
R8099:Sltm UTSW 9 70586078 missense probably damaging 1.00
R8698:Sltm UTSW 9 70587070 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TGGTAGATAAGACACACCACTTTGTC -3'
(R):5'- AAGCCTTAGGTGATAGGATTCTAAG -3'

Sequencing Primer
(F):5'- GATAAGACACACCACTTTGTCTCTAG -3'
(R):5'- CTAAGTTCTGAGACCTCCAT -3'
Posted On2020-09-02