Mutagenetix > Incidental Mutations

Incidental Mutation 'R0040:Kank4'

64659

Institutional Source

Beutler Lab

Gene Symbol

Kank4

Ensembl Gene

ENSMUSG00000035407

Gene Name

KN motif and ankyrin repeat domains 4

Synonyms

Ankrd38

MMRRC Submission

038334-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.075) question?

Stock #

R0040 (G1)

Quality Score

159

Status

Validated

Chromosome

Chromosomal Location

98754898-98817537 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 98779220 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 330 (V330A)

Ref Sequence

ENSEMBL: ENSMUSP00000099851 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102790]

Predicted Effect

probably benign
Transcript: ENSMUST00000102790
AA Change: V330A

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000099851
Gene: ENSMUSG00000035407
AA Change: V330A

Domain	Start	End	E-Value	Type
Pfam:KN_motif	24	62	5.6e-26	PFAM
low complexity region	280	295	N/A	INTRINSIC
low complexity region	300	320	N/A	INTRINSIC
coiled coil region	345	409	N/A	INTRINSIC
low complexity region	505	521	N/A	INTRINSIC
low complexity region	600	624	N/A	INTRINSIC
low complexity region	625	655	N/A	INTRINSIC
low complexity region	685	709	N/A	INTRINSIC
ANK	838	868	7.42e-4	SMART
ANK	877	905	2.08e3	SMART
ANK	910	939	1.11e-2	SMART
ANK	943	973	8.99e-3	SMART
ANK	977	1006	2.43e3	SMART

Meta Mutation Damage Score

0.0725

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 93.6%

Validation Efficiency

100% (88/88)

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahrr	G	A	13: 74,283,024		probably benign	Het
Antxr2	G	A	5: 97,938,425	T441I	possibly damaging	Het
Apcs	A	G	1: 172,894,456	Y108H	probably benign	Het
Atad5	A	G	11: 80,098,014	T666A	probably benign	Het
Atcay	C	T	10: 81,210,519		probably null	Het
Bahcc1	A	G	11: 120,268,370	D141G	probably damaging	Het
Ceacam10	A	G	7: 24,778,264	Y68C	probably damaging	Het
Cfap54	T	A	10: 92,977,039	Q1344L	probably benign	Het
Cyb5r4	A	G	9: 87,066,742		probably null	Het
Cyp2b9	G	T	7: 26,173,474	S14I	possibly damaging	Het
Dusp12	A	G	1: 170,880,657	Y164H	probably damaging	Het
Eml2	T	C	7: 19,196,614	V373A	possibly damaging	Het
Fat1	A	G	8: 45,026,404	D2829G	probably damaging	Het
Fbxl13	T	C	5: 21,486,373	T671A	probably damaging	Het
Fbxo28	G	T	1: 182,326,240		probably benign	Het
Fbxo44	A	G	4: 148,158,695	L89P	probably damaging	Het
Fndc3b	T	A	3: 27,556,117		probably null	Het
Gm884	G	A	11: 103,542,990	P942S	probably damaging	Het
Gm9955	G	T	18: 24,709,152		probably benign	Het
Gprc6a	T	A	10: 51,614,984	K819*	probably null	Het
Gxylt1	A	T	15: 93,254,555		probably benign	Het
Hspa12a	T	C	19: 58,799,624	T589A	probably benign	Het
Idh2	A	G	7: 80,097,822	S317P	probably damaging	Het
Ifi30	T	C	8: 70,763,776		probably null	Het
Ifna16	G	A	4: 88,676,630	A76V	probably benign	Het
Itpr2	C	T	6: 146,345,140	E1127K	probably damaging	Het
Kpna1	T	A	16: 36,023,241	D328E	probably damaging	Het
Krt71	T	A	15: 101,738,433	H280L	possibly damaging	Het
Mapt	A	G	11: 104,305,398	M446V	probably damaging	Het
Med1	C	T	11: 98,166,255		probably null	Het
Mif	T	A	10: 75,859,780	H63L	probably damaging	Het
Mycbp2	A	G	14: 103,224,272	V1447A	probably benign	Het
Myo1b	A	T	1: 51,781,989	I451N	probably damaging	Het
Nme2	A	T	11: 93,951,930		probably null	Het
Nubp1	A	G	16: 10,421,117	T199A	probably damaging	Het
Nup210l	T	A	3: 90,181,905	V1165D	probably damaging	Het
Nup98	T	A	7: 102,192,034	T122S	probably damaging	Het
Olfr1106	C	T	2: 87,049,204	E11K	probably damaging	Het
Olfr304	A	T	7: 86,386,507	L51Q	probably benign	Het
Olfr354	T	C	2: 36,907,458	F171L	probably damaging	Het
Olfr771	T	A	10: 129,160,739	I82L	probably benign	Het
Pard3b	A	T	1: 62,637,820	Y1170F	probably damaging	Het
Pear1	T	C	3: 87,754,358	D536G	probably damaging	Het
Phrf1	G	T	7: 141,243,857	R196L	probably damaging	Het
Plxna2	G	T	1: 194,643,896	R46L	probably benign	Het
Rbm39	G	A	2: 156,148,179	T496I	possibly damaging	Het
Rpl14	C	G	9: 120,572,101	F3L	possibly damaging	Het
Rtf2	G	A	2: 172,444,696	S40N	probably damaging	Het
Runx2	G	A	17: 44,608,254	S481L	possibly damaging	Het
Sh3rf1	T	A	8: 61,329,252	Y143N	possibly damaging	Het
Siglec15	G	A	18: 78,048,877		probably benign	Het
Slc4a8	T	A	15: 100,789,846	I288N	probably damaging	Het
Ttc38	C	A	15: 85,841,489	F184L	probably damaging	Het
Vmn1r28	T	C	6: 58,265,894	Y241H	probably damaging	Het
Vmn2r110	A	T	17: 20,596,084	V59D	probably benign	Het
Wdpcp	A	G	11: 21,711,638	I303M	probably damaging	Het
Zc3h12d	G	A	10: 7,867,914	A483T	probably benign	Het
Zfp106	C	A	2: 120,531,613	K1008N	probably damaging	Het
Zfp334	A	G	2: 165,381,572	Y184H	probably benign	Het
Zfp68	G	A	5: 138,607,779	T94I	probably benign	Het
Zkscan3	A	T	13: 21,394,920		probably null	Het

Other mutations in Kank4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01069:Kank4	APN	4	98778395	missense	probably damaging	0.99
IGL02634:Kank4	APN	4	98778827	missense	probably benign	0.06
IGL02883:Kank4	APN	4	98773453	missense	possibly damaging	0.87
R0040:Kank4	UTSW	4	98779220	missense	probably benign	0.03
R0081:Kank4	UTSW	4	98778330	missense	probably benign	0.02
R0219:Kank4	UTSW	4	98778465	missense	probably benign	0.06
R0498:Kank4	UTSW	4	98779636	missense	probably benign
R0609:Kank4	UTSW	4	98777105	missense	probably damaging	0.99
R0855:Kank4	UTSW	4	98771444	missense	probably damaging	1.00
R0865:Kank4	UTSW	4	98774663	splice site	probably benign
R0961:Kank4	UTSW	4	98756519	missense	probably benign	0.02
R1172:Kank4	UTSW	4	98765569	missense	probably damaging	1.00
R1173:Kank4	UTSW	4	98765569	missense	probably damaging	1.00
R1175:Kank4	UTSW	4	98765569	missense	probably damaging	1.00
R1381:Kank4	UTSW	4	98779938	missense	probably damaging	0.98
R1517:Kank4	UTSW	4	98779029	missense	possibly damaging	0.83
R1573:Kank4	UTSW	4	98774836	nonsense	probably null
R1668:Kank4	UTSW	4	98778896	missense	probably damaging	0.98
R2051:Kank4	UTSW	4	98780102	missense	probably damaging	0.99
R2253:Kank4	UTSW	4	98779226	missense	probably damaging	0.99
R2656:Kank4	UTSW	4	98778957	missense	probably damaging	0.99
R3801:Kank4	UTSW	4	98780133	missense	probably damaging	0.97
R3802:Kank4	UTSW	4	98780133	missense	probably damaging	0.97
R3804:Kank4	UTSW	4	98780133	missense	probably damaging	0.97
R3945:Kank4	UTSW	4	98771280	missense	probably damaging	1.00
R4172:Kank4	UTSW	4	98779121	missense	probably damaging	1.00
R4502:Kank4	UTSW	4	98777098	missense	possibly damaging	0.89
R4503:Kank4	UTSW	4	98777098	missense	possibly damaging	0.89
R5024:Kank4	UTSW	4	98785661	missense	probably damaging	0.99
R5105:Kank4	UTSW	4	98779159	missense	probably benign	0.01
R5122:Kank4	UTSW	4	98756567	missense	probably damaging	1.00
R5255:Kank4	UTSW	4	98778972	missense	probably benign
R5484:Kank4	UTSW	4	98774785	missense	probably benign
R5517:Kank4	UTSW	4	98774881	missense	probably damaging	1.00
R5550:Kank4	UTSW	4	98771441	missense	probably benign	0.27
R5667:Kank4	UTSW	4	98765461	critical splice donor site	probably null
R5671:Kank4	UTSW	4	98765461	critical splice donor site	probably null
R5865:Kank4	UTSW	4	98771393	missense	possibly damaging	0.50
R6176:Kank4	UTSW	4	98765554	missense	probably damaging	1.00
R6778:Kank4	UTSW	4	98761505	missense	probably benign	0.01
R7084:Kank4	UTSW	4	98771345	missense	probably damaging	1.00
R7085:Kank4	UTSW	4	98779946	missense	probably benign
R7112:Kank4	UTSW	4	98761521	missense	probably damaging	0.99
R8307:Kank4	UTSW	4	98778678	nonsense	probably null
R8431:Kank4	UTSW	4	98779272	missense	probably benign	0.33
R8447:Kank4	UTSW	4	98778492	missense	probably damaging	0.99
R8483:Kank4	UTSW	4	98771378	missense	probably damaging	1.00
R8505:Kank4	UTSW	4	98785676	start gained	probably benign
X0027:Kank4	UTSW	4	98779923	missense	probably benign	0.00
Z1176:Kank4	UTSW	4	98778294	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TCAGTGTTCACCGTGGCATCAG -3'
(R):5'- ACCTCAAGGCTTCAAGTCACCTCTC -3'

Sequencing Primer
(F):5'- TCTTCTAAATGGGCTACAGTGC -3'
(R):5'- AGTCACCTCTCTCAGCCAGG -3'

Posted On

2013-08-06