Incidental Mutation 'R8374:Gldc'
ID646603
Institutional Source Beutler Lab
Gene Symbol Gldc
Ensembl Gene ENSMUSG00000024827
Gene Nameglycine decarboxylase
SynonymsD030049L12Rik, D19Wsu57e
MMRRC Submission
Accession Numbers

Genbank: NM_138595.1

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8374 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location30098449-30175418 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 30137194 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 439 (F439V)
Ref Sequence ENSEMBL: ENSMUSP00000025778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025778]
Predicted Effect probably damaging
Transcript: ENSMUST00000025778
AA Change: F439V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827
AA Change: F439V

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
low complexity region 33 56 N/A INTRINSIC
Pfam:GDC-P 70 493 1.1e-202 PFAM
low complexity region 504 515 N/A INTRINSIC
Pfam:GDC-P 519 798 6.5e-8 PFAM
Pfam:Beta_elim_lyase 589 745 2e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 C T 9: 30,902,706 G721E probably benign Het
Aip A T 19: 4,115,456 M170K probably damaging Het
Alms1 T C 6: 85,608,991 I276T probably benign Het
Arid1b C T 17: 5,342,644 P2097S possibly damaging Het
Astn1 T G 1: 158,502,233 N219K probably damaging Het
Cbx2 G T 11: 119,028,143 R178L probably damaging Het
Clptm1 G A 7: 19,638,156 P252S probably benign Het
Crebbp A G 16: 4,084,311 S2355P probably damaging Het
D130043K22Rik C A 13: 24,857,979 T297K probably benign Het
Ddx60 A G 8: 61,974,171 D760G probably benign Het
Dgka T C 10: 128,721,243 N621S probably benign Het
Ear10 A T 14: 43,923,188 C61S probably damaging Het
F12 A T 13: 55,421,331 C238S probably damaging Het
Fen1 A G 19: 10,200,460 F207L probably benign Het
Fzr1 A G 10: 81,367,534 L486P probably damaging Het
Gdnf A G 15: 7,834,695 R196G probably benign Het
Gm3138 T C 14: 4,251,688 M120T probably damaging Het
Gpi1 G A 7: 34,220,657 A197V probably benign Het
Ighv1-4 T A 12: 114,487,279 I70F probably benign Het
Il19 A T 1: 130,939,156 L29Q probably damaging Het
Kank1 A T 19: 25,411,641 I893F probably damaging Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Kif13b T C 14: 64,788,435 S1414P probably damaging Het
Mettl11b A T 1: 163,703,048 M274K probably damaging Het
Miga2 AAGAG AAG 2: 30,375,743 probably null Het
Mosmo T A 7: 120,730,492 M112K probably benign Het
Olfr317 T A 11: 58,732,898 D89V probably damaging Het
Olfr715b A G 7: 107,106,826 F12L probably damaging Het
Olfr93 C A 17: 37,151,745 V76F probably damaging Het
Pak6 G A 2: 118,693,996 V497I probably benign Het
Ppargc1b G A 18: 61,310,493 S549F probably damaging Het
Rassf8 T A 6: 145,815,137 L63* probably null Het
Rptn G T 3: 93,396,295 G312* probably null Het
Rsph14 T C 10: 74,961,649 I169V probably benign Het
Sltm A G 9: 70,561,945 D162G probably null Het
Tatdn1 C T 15: 58,916,151 probably null Het
Tbx4 A C 11: 85,914,276 E397A probably benign Het
Tdrd12 T C 7: 35,478,061 D956G unknown Het
Tnr G A 1: 159,858,383 V395I probably benign Het
Ugt1a2 A T 1: 88,201,385 H250L possibly damaging Het
Vmn1r173 C T 7: 23,702,495 H52Y probably damaging Het
Vps11 T C 9: 44,356,409 D302G probably benign Het
Zfp398 T C 6: 47,859,534 probably null Het
Other mutations in Gldc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Gldc APN 19 30115240 missense probably damaging 1.00
IGL01016:Gldc APN 19 30133493 missense possibly damaging 0.93
IGL01112:Gldc APN 19 30158513 critical splice donor site probably null
IGL01510:Gldc APN 19 30113721 critical splice donor site probably null
IGL01516:Gldc APN 19 30099032 missense probably damaging 1.00
IGL01598:Gldc APN 19 30133756 missense probably damaging 1.00
IGL01646:Gldc APN 19 30100765 missense possibly damaging 0.61
IGL02024:Gldc APN 19 30100827 missense probably damaging 1.00
IGL02125:Gldc APN 19 30147241 missense probably benign 0.03
IGL02548:Gldc APN 19 30099899 missense probably benign
IGL02711:Gldc APN 19 30145146 critical splice donor site probably null
IGL02818:Gldc APN 19 30136509 missense probably damaging 0.99
IGL02982:Gldc APN 19 30145145 critical splice donor site probably null
IGL03165:Gldc APN 19 30098993 missense possibly damaging 0.61
jojoba UTSW 19 30133512 missense probably damaging 1.00
miserable UTSW 19 30151536 missense probably damaging 1.00
Urchin UTSW 19 30118602 missense probably damaging 0.98
I2289:Gldc UTSW 19 30147176 nonsense probably null
R0180:Gldc UTSW 19 30100817 missense possibly damaging 0.95
R0269:Gldc UTSW 19 30118602 missense probably damaging 0.98
R0277:Gldc UTSW 19 30116451 missense possibly damaging 0.84
R1085:Gldc UTSW 19 30151428 missense probably damaging 1.00
R1159:Gldc UTSW 19 30160762 intron probably benign
R1500:Gldc UTSW 19 30113825 missense possibly damaging 0.88
R1507:Gldc UTSW 19 30118638 missense probably damaging 1.00
R1592:Gldc UTSW 19 30160677 intron probably benign
R1593:Gldc UTSW 19 30113750 missense probably damaging 1.00
R1675:Gldc UTSW 19 30143453 missense probably damaging 1.00
R1869:Gldc UTSW 19 30139332 missense probably benign
R1965:Gldc UTSW 19 30137113 nonsense probably null
R2312:Gldc UTSW 19 30100826 missense probably damaging 0.98
R2425:Gldc UTSW 19 30131790 missense probably damaging 1.00
R3836:Gldc UTSW 19 30118675 splice site probably benign
R3837:Gldc UTSW 19 30118675 splice site probably benign
R3839:Gldc UTSW 19 30118675 splice site probably benign
R4191:Gldc UTSW 19 30145658 missense probably damaging 0.96
R4380:Gldc UTSW 19 30160768 intron probably benign
R4508:Gldc UTSW 19 30143407 missense probably damaging 1.00
R4570:Gldc UTSW 19 30174439 missense probably benign
R4655:Gldc UTSW 19 30160702 intron probably benign
R4842:Gldc UTSW 19 30133732 missense possibly damaging 0.94
R5070:Gldc UTSW 19 30118598 missense possibly damaging 0.84
R5085:Gldc UTSW 19 30151536 missense probably damaging 1.00
R5268:Gldc UTSW 19 30145725 missense probably damaging 0.96
R5368:Gldc UTSW 19 30158521 missense probably benign
R5718:Gldc UTSW 19 30110772 nonsense probably null
R5878:Gldc UTSW 19 30143467 splice site probably null
R6192:Gldc UTSW 19 30133772 missense probably damaging 0.98
R6453:Gldc UTSW 19 30116517 missense probably damaging 0.99
R6777:Gldc UTSW 19 30133512 missense probably damaging 1.00
R6865:Gldc UTSW 19 30133762 missense possibly damaging 0.92
R7332:Gldc UTSW 19 30116526 missense probably damaging 0.99
R7390:Gldc UTSW 19 30099914 missense possibly damaging 0.46
R7647:Gldc UTSW 19 30118667 missense probably damaging 0.96
R8081:Gldc UTSW 19 30158587 frame shift probably null
R8171:Gldc UTSW 19 30133761 missense probably benign 0.24
R8321:Gldc UTSW 19 30143407 nonsense probably null
R8503:Gldc UTSW 19 30099854 missense probably benign 0.26
R8510:Gldc UTSW 19 30116505 missense probably damaging 1.00
R8785:Gldc UTSW 19 30115234 missense probably damaging 1.00
R8818:Gldc UTSW 19 30100812 missense probably benign 0.05
R8820:Gldc UTSW 19 30100812 missense probably benign 0.05
R8829:Gldc UTSW 19 30100812 missense probably benign 0.05
R8830:Gldc UTSW 19 30100812 missense probably benign 0.05
R8859:Gldc UTSW 19 30139379 missense probably damaging 1.00
Z1177:Gldc UTSW 19 30110778 missense probably damaging 1.00
Z1177:Gldc UTSW 19 30110779 missense probably damaging 0.99
Z1177:Gldc UTSW 19 30145748 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- CTGAGGACAATCTGCTTCTTTG -3'
(R):5'- ACAATGAGATTGCACCCATTTC -3'

Sequencing Primer
(F):5'- GAGGACAATCTGCTTCTTTGAAAAG -3'
(R):5'- TGAGATTGCACCCATTTCTAATATG -3'
Posted On2020-09-02