Incidental Mutation 'R8375:Map4k4'
ID646604
Institutional Source Beutler Lab
Gene Symbol Map4k4
Ensembl Gene ENSMUSG00000026074
Gene Namemitogen-activated protein kinase kinase kinase kinase 4
Synonyms9430080K19Rik, Nik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8375 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location39900913-40026310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40024641 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1199 (S1199P)
Ref Sequence ENSEMBL: ENSMUSP00000141862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163854] [ENSMUST00000168431] [ENSMUST00000192509] [ENSMUST00000193682] [ENSMUST00000195259] [ENSMUST00000195636] [ENSMUST00000195860]
Predicted Effect probably damaging
Transcript: ENSMUST00000163854
AA Change: S1266P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126961
Gene: ENSMUSG00000026074
AA Change: S1266P

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 721 747 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 811 837 N/A INTRINSIC
low complexity region 891 904 N/A INTRINSIC
low complexity region 919 929 N/A INTRINSIC
CNH 970 1268 2.76e-127 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000129796
Gene: ENSMUSG00000026074
AA Change: S1216P

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 633 644 N/A INTRINSIC
low complexity region 667 693 N/A INTRINSIC
low complexity region 700 709 N/A INTRINSIC
low complexity region 757 783 N/A INTRINSIC
low complexity region 837 850 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
CNH 916 1214 2.76e-127 SMART
Predicted Effect unknown
Transcript: ENSMUST00000192509
AA Change: S1212P
SMART Domains Protein: ENSMUSP00000141665
Gene: ENSMUSG00000026074
AA Change: S1212P

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 633 644 N/A INTRINSIC
low complexity region 667 693 N/A INTRINSIC
low complexity region 700 709 N/A INTRINSIC
low complexity region 757 783 N/A INTRINSIC
low complexity region 837 850 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
CNH 916 1214 2.76e-127 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000193682
AA Change: S1199P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141862
Gene: ENSMUSG00000026074
AA Change: S1199P

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
low complexity region 590 616 N/A INTRINSIC
low complexity region 623 632 N/A INTRINSIC
low complexity region 680 706 N/A INTRINSIC
low complexity region 785 814 N/A INTRINSIC
low complexity region 824 837 N/A INTRINSIC
low complexity region 852 862 N/A INTRINSIC
CNH 903 1201 2.76e-127 SMART
Predicted Effect unknown
Transcript: ENSMUST00000195259
AA Change: S1186P
SMART Domains Protein: ENSMUSP00000142056
Gene: ENSMUSG00000026074
AA Change: S1186P

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 610 621 N/A INTRINSIC
low complexity region 644 670 N/A INTRINSIC
low complexity region 677 686 N/A INTRINSIC
low complexity region 731 757 N/A INTRINSIC
low complexity region 811 824 N/A INTRINSIC
low complexity region 839 849 N/A INTRINSIC
CNH 890 1188 2.76e-127 SMART
Predicted Effect unknown
Transcript: ENSMUST00000195636
AA Change: S1250P
SMART Domains Protein: ENSMUSP00000141613
Gene: ENSMUSG00000026074
AA Change: S1250P

DomainStartEndE-ValueType
S_TKc 25 289 3.4e-97 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 610 621 N/A INTRINSIC
low complexity region 644 670 N/A INTRINSIC
low complexity region 677 686 N/A INTRINSIC
low complexity region 731 757 N/A INTRINSIC
low complexity region 836 865 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
low complexity region 903 913 N/A INTRINSIC
CNH 954 1252 1.4e-129 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000195860
AA Change: S1266P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141400
Gene: ENSMUSG00000026074
AA Change: S1266P

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 721 747 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 811 837 N/A INTRINSIC
low complexity region 891 904 N/A INTRINSIC
low complexity region 919 929 N/A INTRINSIC
CNH 970 1268 2.76e-127 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine protein kinase family. This kinase has been shown to specifically activate MAPK8/JNK. The activation of MAPK8 by this kinase is found to be inhibited by the dominant-negative mutants of MAP3K7/TAK1, MAP2K4/MKK4, and MAP2K7/MKK7, which suggests that this kinase may function through the MAP3K7-MAP2K4-MAP2K7 kinase cascade, and mediate the TNF-alpha signaling pathway. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos around day E9.5-10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C A 11: 9,315,416 F3030L probably benign Het
Abca13 A T 11: 9,397,841 I3565F probably damaging Het
Ak7 A T 12: 105,742,341 I352F probably damaging Het
Alkal2 G T 12: 30,884,851 G23V probably damaging Het
Anapc7 C T 5: 122,428,279 P84S probably benign Het
Apol7a A T 15: 77,389,347 I305N probably damaging Het
Asf1b C T 8: 83,967,930 R108C probably damaging Het
Bicd1 A T 6: 149,520,491 E903D probably benign Het
Bpifb3 A T 2: 153,925,795 I263F probably benign Het
Cavin3 T A 7: 105,481,021 S195C probably damaging Het
Chsy3 C A 18: 59,179,513 R353S probably damaging Het
Col5a2 A G 1: 45,442,730 V78A unknown Het
Cpxm1 C T 2: 130,394,226 E339K probably damaging Het
Cyp26c1 G T 19: 37,687,212 A175S probably benign Het
Dnah5 A T 15: 28,327,343 T2069S probably benign Het
Ednrb A G 14: 103,819,947 F393S probably damaging Het
Fstl4 T C 11: 53,162,675 S385P possibly damaging Het
Gabpb2 G A 3: 95,204,798 S40L probably damaging Het
Gabrb1 T C 5: 72,029,829 I155T probably damaging Het
Hc T A 2: 34,983,719 N1668Y probably benign Het
Kcnh1 A G 1: 192,434,816 H670R probably damaging Het
Krt31 G A 11: 100,047,777 A330V probably benign Het
Lrfn2 T A 17: 49,096,823 M658K possibly damaging Het
Lrrc1 T A 9: 77,457,847 N184I probably damaging Het
Lrrc69 T C 4: 14,795,994 I18V probably benign Het
Lvrn G A 18: 46,850,222 V11M probably damaging Het
Mib1 T C 18: 10,768,233 probably null Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Myo18b C T 5: 112,760,393 V2005I possibly damaging Het
Myo6 T A 9: 80,254,924 H314Q unknown Het
Nat8f6 A C 6: 85,808,906 M87R probably benign Het
Net1 A G 13: 3,893,458 probably benign Het
Notch4 C T 17: 34,568,254 T294I possibly damaging Het
Nrros A G 16: 32,147,638 L36P probably damaging Het
Olfr25 G C 9: 38,329,935 W113S probably benign Het
Olfr870 T C 9: 20,170,741 M277V probably benign Het
Padi3 T C 4: 140,798,096 H202R probably damaging Het
Pik3ap1 A T 19: 41,328,099 M284K probably damaging Het
Prr27 C A 5: 87,842,851 Y107* probably null Het
Rab5c G T 11: 100,716,783 N188K probably damaging Het
Rlf A T 4: 121,148,335 S1259R probably damaging Het
Rrm2 T C 12: 24,712,752 V298A probably damaging Het
Rtn4rl2 A T 2: 84,880,689 L77H possibly damaging Het
Skint4 A G 4: 112,117,976 I44M probably damaging Het
Spaca7 T C 8: 12,598,998 I164T probably benign Het
Spg7 A G 8: 123,073,829 S153G probably damaging Het
Spink5 T C 18: 43,990,719 S358P probably benign Het
Stx5a T C 19: 8,755,098 M377T unknown Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Ttc41 A G 10: 86,763,980 D1048G probably damaging Het
Ttn A T 2: 76,727,165 W29862R probably damaging Het
Vmn1r203 T G 13: 22,524,984 *312G probably null Het
Vmn2r74 T G 7: 85,952,706 T575P possibly damaging Het
Zfp14 A T 7: 30,039,154 N135K possibly damaging Het
Other mutations in Map4k4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Map4k4 APN 1 40004816 missense probably damaging 0.99
IGL00417:Map4k4 APN 1 40014532 missense possibly damaging 0.92
IGL00516:Map4k4 APN 1 40014602 missense probably damaging 1.00
IGL01545:Map4k4 APN 1 40014229 splice site probably benign
IGL02092:Map4k4 APN 1 39986783 missense probably benign 0.12
IGL02092:Map4k4 APN 1 40024348 missense probably damaging 1.00
IGL02570:Map4k4 APN 1 39980579 missense probably benign 0.06
IGL02626:Map4k4 APN 1 40014097 splice site probably benign
IGL02993:Map4k4 APN 1 40014188 missense probably damaging 0.98
IGL03178:Map4k4 APN 1 39986693 missense possibly damaging 0.63
tank UTSW 1 40004864 missense possibly damaging 0.93
IGL02835:Map4k4 UTSW 1 40010600 missense probably damaging 0.99
R0496:Map4k4 UTSW 1 40006822 missense probably damaging 0.99
R0498:Map4k4 UTSW 1 39990178 missense probably benign 0.22
R0588:Map4k4 UTSW 1 40004864 missense possibly damaging 0.93
R0674:Map4k4 UTSW 1 40003815 missense probably damaging 1.00
R1205:Map4k4 UTSW 1 40003844 missense probably damaging 1.00
R1349:Map4k4 UTSW 1 40021159 missense probably damaging 1.00
R1615:Map4k4 UTSW 1 40006830 splice site probably benign
R1763:Map4k4 UTSW 1 40000757 splice site probably benign
R1800:Map4k4 UTSW 1 40023460 missense probably damaging 1.00
R1893:Map4k4 UTSW 1 40001557 missense probably benign 0.08
R2411:Map4k4 UTSW 1 40007496 missense probably damaging 0.96
R2851:Map4k4 UTSW 1 40000755 splice site probably benign
R2852:Map4k4 UTSW 1 40000755 splice site probably benign
R2987:Map4k4 UTSW 1 39986765 missense probably damaging 1.00
R3087:Map4k4 UTSW 1 40021082 critical splice acceptor site probably null
R3688:Map4k4 UTSW 1 39985171 splice site probably null
R4075:Map4k4 UTSW 1 40023462 missense probably damaging 0.96
R4304:Map4k4 UTSW 1 39973972 missense possibly damaging 0.74
R4564:Map4k4 UTSW 1 39988975 missense probably damaging 1.00
R4569:Map4k4 UTSW 1 40000538 missense probably damaging 1.00
R4613:Map4k4 UTSW 1 40017191 missense probably benign 0.05
R4715:Map4k4 UTSW 1 40019564 missense probably damaging 1.00
R4788:Map4k4 UTSW 1 40003916 missense probably benign 0.01
R4926:Map4k4 UTSW 1 40017225 missense probably damaging 1.00
R4943:Map4k4 UTSW 1 40019594 missense probably damaging 0.99
R5033:Map4k4 UTSW 1 40007502 missense probably damaging 0.99
R5177:Map4k4 UTSW 1 39986762 missense probably damaging 1.00
R5297:Map4k4 UTSW 1 39962217 missense probably damaging 1.00
R5844:Map4k4 UTSW 1 39999876 splice site probably benign
R5952:Map4k4 UTSW 1 39999922 unclassified probably benign
R6111:Map4k4 UTSW 1 40011662 missense probably benign 0.00
R6125:Map4k4 UTSW 1 40003965 missense possibly damaging 0.77
R6838:Map4k4 UTSW 1 39976722 missense probably damaging 1.00
R6927:Map4k4 UTSW 1 40011682 missense probably benign 0.00
R7008:Map4k4 UTSW 1 39988971 missense probably benign 0.44
R7164:Map4k4 UTSW 1 39973972 missense possibly damaging 0.74
R7195:Map4k4 UTSW 1 40019669 missense possibly damaging 0.93
R7352:Map4k4 UTSW 1 39962227 missense unknown
R7589:Map4k4 UTSW 1 40021091 nonsense probably null
R7816:Map4k4 UTSW 1 40014208 missense possibly damaging 0.53
R7869:Map4k4 UTSW 1 39974044 missense unknown
R8013:Map4k4 UTSW 1 39962212 missense unknown
R8145:Map4k4 UTSW 1 40000534 missense
R8154:Map4k4 UTSW 1 40021142 nonsense probably null
R8254:Map4k4 UTSW 1 40006675 missense probably damaging 0.99
R8266:Map4k4 UTSW 1 40011653 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- CACTTGTGGCTGCTGTGTAC -3'
(R):5'- AAGCACTCCTAGCACCGATG -3'

Sequencing Primer
(F):5'- ACAGTGGCTTGTGGTCCAC -3'
(R):5'- ACCGATGGTGGAGTCCAGAC -3'
Posted On2020-09-02