Incidental Mutation 'R8375:Skint4'
ID646615
Institutional Source Beutler Lab
Gene Symbol Skint4
Ensembl Gene ENSMUSG00000055960
Gene Nameselection and upkeep of intraepithelial T cells 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R8375 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location112072016-112168076 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112117976 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 44 (I44M)
Ref Sequence ENSEMBL: ENSMUSP00000102176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069769] [ENSMUST00000106564] [ENSMUST00000106565] [ENSMUST00000106566]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069769
AA Change: I36M

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000070676
Gene: ENSMUSG00000055960
AA Change: I36M

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 33 140 7.24e-10 SMART
Pfam:C2-set_2 141 227 6.2e-8 PFAM
transmembrane domain 242 264 N/A INTRINSIC
transmembrane domain 296 318 N/A INTRINSIC
transmembrane domain 342 364 N/A INTRINSIC
transmembrane domain 383 405 N/A INTRINSIC
transmembrane domain 425 447 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106564
AA Change: I36M

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102174
Gene: ENSMUSG00000055960
AA Change: I36M

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 33 140 7.24e-10 SMART
Pfam:C2-set_2 141 227 6.2e-8 PFAM
transmembrane domain 242 264 N/A INTRINSIC
transmembrane domain 296 318 N/A INTRINSIC
transmembrane domain 342 364 N/A INTRINSIC
transmembrane domain 383 405 N/A INTRINSIC
transmembrane domain 425 447 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106565
AA Change: I36M

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102175
Gene: ENSMUSG00000055960
AA Change: I36M

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 33 140 7.24e-10 SMART
Pfam:C2-set_2 141 227 6.2e-8 PFAM
transmembrane domain 242 264 N/A INTRINSIC
transmembrane domain 296 318 N/A INTRINSIC
transmembrane domain 342 364 N/A INTRINSIC
transmembrane domain 383 405 N/A INTRINSIC
transmembrane domain 425 447 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106566
AA Change: I44M

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102176
Gene: ENSMUSG00000055960
AA Change: I44M

DomainStartEndE-ValueType
IG 41 148 7.24e-10 SMART
transmembrane domain 250 272 N/A INTRINSIC
transmembrane domain 304 326 N/A INTRINSIC
transmembrane domain 350 372 N/A INTRINSIC
transmembrane domain 391 413 N/A INTRINSIC
transmembrane domain 433 455 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C A 11: 9,315,416 F3030L probably benign Het
Abca13 A T 11: 9,397,841 I3565F probably damaging Het
Ak7 A T 12: 105,742,341 I352F probably damaging Het
Alkal2 G T 12: 30,884,851 G23V probably damaging Het
Anapc7 C T 5: 122,428,279 P84S probably benign Het
Apol7a A T 15: 77,389,347 I305N probably damaging Het
Asf1b C T 8: 83,967,930 R108C probably damaging Het
Bicd1 A T 6: 149,520,491 E903D probably benign Het
Bpifb3 A T 2: 153,925,795 I263F probably benign Het
Cavin3 T A 7: 105,481,021 S195C probably damaging Het
Chsy3 C A 18: 59,179,513 R353S probably damaging Het
Col5a2 A G 1: 45,442,730 V78A unknown Het
Cpxm1 C T 2: 130,394,226 E339K probably damaging Het
Cyp26c1 G T 19: 37,687,212 A175S probably benign Het
Dnah5 A T 15: 28,327,343 T2069S probably benign Het
Ednrb A G 14: 103,819,947 F393S probably damaging Het
Fstl4 T C 11: 53,162,675 S385P possibly damaging Het
Gabpb2 G A 3: 95,204,798 S40L probably damaging Het
Gabrb1 T C 5: 72,029,829 I155T probably damaging Het
Hc T A 2: 34,983,719 N1668Y probably benign Het
Kcnh1 A G 1: 192,434,816 H670R probably damaging Het
Krt31 G A 11: 100,047,777 A330V probably benign Het
Lrfn2 T A 17: 49,096,823 M658K possibly damaging Het
Lrrc1 T A 9: 77,457,847 N184I probably damaging Het
Lrrc69 T C 4: 14,795,994 I18V probably benign Het
Lvrn G A 18: 46,850,222 V11M probably damaging Het
Map4k4 T C 1: 40,024,641 S1199P possibly damaging Het
Mib1 T C 18: 10,768,233 probably null Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Myo18b C T 5: 112,760,393 V2005I possibly damaging Het
Myo6 T A 9: 80,254,924 H314Q unknown Het
Nat8f6 A C 6: 85,808,906 M87R probably benign Het
Net1 A G 13: 3,893,458 probably benign Het
Notch4 C T 17: 34,568,254 T294I possibly damaging Het
Nrros A G 16: 32,147,638 L36P probably damaging Het
Olfr25 G C 9: 38,329,935 W113S probably benign Het
Olfr870 T C 9: 20,170,741 M277V probably benign Het
Padi3 T C 4: 140,798,096 H202R probably damaging Het
Pik3ap1 A T 19: 41,328,099 M284K probably damaging Het
Prr27 C A 5: 87,842,851 Y107* probably null Het
Rab5c G T 11: 100,716,783 N188K probably damaging Het
Rlf A T 4: 121,148,335 S1259R probably damaging Het
Rrm2 T C 12: 24,712,752 V298A probably damaging Het
Rtn4rl2 A T 2: 84,880,689 L77H possibly damaging Het
Spaca7 T C 8: 12,598,998 I164T probably benign Het
Spg7 A G 8: 123,073,829 S153G probably damaging Het
Spink5 T C 18: 43,990,719 S358P probably benign Het
Stx5a T C 19: 8,755,098 M377T unknown Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Ttc41 A G 10: 86,763,980 D1048G probably damaging Het
Ttn A T 2: 76,727,165 W29862R probably damaging Het
Vmn1r203 T G 13: 22,524,984 *312G probably null Het
Vmn2r74 T G 7: 85,952,706 T575P possibly damaging Het
Zfp14 A T 7: 30,039,154 N135K possibly damaging Het
Other mutations in Skint4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Skint4 APN 4 112120010 missense possibly damaging 0.86
IGL01654:Skint4 APN 4 112120057 missense probably damaging 0.99
IGL02040:Skint4 APN 4 112146482 splice site probably benign
IGL02328:Skint4 APN 4 112120058 missense possibly damaging 0.92
IGL02811:Skint4 APN 4 112087003 missense possibly damaging 0.86
IGL02965:Skint4 APN 4 112136021 missense probably benign 0.01
IGL03039:Skint4 APN 4 112124650 missense probably benign 0.20
IGL03060:Skint4 APN 4 112118235 missense probably benign 0.33
IGL03075:Skint4 APN 4 112087042 missense probably damaging 1.00
IGL03352:Skint4 APN 4 112165686 missense possibly damaging 0.96
PIT4378001:Skint4 UTSW 4 112087035 missense probably benign 0.01
R0483:Skint4 UTSW 4 112117939 splice site probably benign
R1175:Skint4 UTSW 4 112124596 missense probably benign 0.14
R1446:Skint4 UTSW 4 112118114 missense probably benign 0.11
R1641:Skint4 UTSW 4 112136043 missense possibly damaging 0.93
R1983:Skint4 UTSW 4 112146492 missense probably benign 0.00
R2168:Skint4 UTSW 4 112086986 critical splice acceptor site probably null
R2272:Skint4 UTSW 4 112119868 missense probably benign 0.01
R2287:Skint4 UTSW 4 112118205 missense possibly damaging 0.70
R3801:Skint4 UTSW 4 112118181 missense probably damaging 0.98
R3802:Skint4 UTSW 4 112118181 missense probably damaging 0.98
R3804:Skint4 UTSW 4 112118181 missense probably damaging 0.98
R4009:Skint4 UTSW 4 112120109 missense possibly damaging 0.70
R4050:Skint4 UTSW 4 112124614 missense probably benign 0.01
R4564:Skint4 UTSW 4 112119869 missense probably damaging 0.99
R4581:Skint4 UTSW 4 112087042 missense probably damaging 1.00
R4587:Skint4 UTSW 4 112087024 missense probably damaging 0.99
R4674:Skint4 UTSW 4 112118233 missense probably damaging 1.00
R4723:Skint4 UTSW 4 112118236 missense possibly damaging 0.70
R4753:Skint4 UTSW 4 112146531 missense probably benign 0.00
R4775:Skint4 UTSW 4 112136064 missense probably damaging 0.97
R4832:Skint4 UTSW 4 112143766 missense possibly damaging 0.49
R5299:Skint4 UTSW 4 112136006 missense possibly damaging 0.59
R6118:Skint4 UTSW 4 112119822 splice site probably null
R6433:Skint4 UTSW 4 112146510 missense probably benign 0.00
R6616:Skint4 UTSW 4 112118230 missense possibly damaging 0.70
R6698:Skint4 UTSW 4 112119899 missense probably damaging 1.00
R6752:Skint4 UTSW 4 112119863 missense possibly damaging 0.89
R7034:Skint4 UTSW 4 112158084 missense possibly damaging 0.53
R7102:Skint4 UTSW 4 112118101 missense probably damaging 1.00
R7602:Skint4 UTSW 4 112118271 missense possibly damaging 0.50
R8027:Skint4 UTSW 4 112157985 critical splice acceptor site probably null
R8038:Skint4 UTSW 4 112119806 intron probably benign
R8147:Skint4 UTSW 4 112136021 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CACCTCCCATATGTCCTGAAG -3'
(R):5'- TCAGGAGTTCTGTCCGTTCTAC -3'

Sequencing Primer
(F):5'- AGTAGTAACATTTATGCTGCTGC -3'
(R):5'- GAGTTCTGTCCGTTCTACATACTTAG -3'
Posted On2020-09-02