Incidental Mutation 'R8375:Gabrb1'
ID646618
Institutional Source Beutler Lab
Gene Symbol Gabrb1
Ensembl Gene ENSMUSG00000029212
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit beta 1
SynonymsGabrb-1, B230208N19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8375 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location71658113-72149037 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72029829 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 155 (I155T)
Ref Sequence ENSEMBL: ENSMUSP00000031122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031122] [ENSMUST00000199967]
Predicted Effect probably damaging
Transcript: ENSMUST00000031122
AA Change: I155T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031122
Gene: ENSMUSG00000029212
AA Change: I155T

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Neur_chan_LBD 37 243 7.1e-52 PFAM
Pfam:Neur_chan_memb 250 469 2.4e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199967
AA Change: I122T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143682
Gene: ENSMUSG00000029212
AA Change: I122T

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 4 210 4.8e-51 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. This gene encodes GABA A receptor, beta 1 subunit. It is mapped to chromosome 4p12 in a cluster comprised of genes encoding alpha 4, alpha 2 and gamma 1 subunits of the GABA A receptor. Alteration of this gene is implicated in the pathogenetics of schizophrenia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for an ENU or spontaneous mutation exhibit alcohol preference with increased tonic inhibition, female infertility and hypothalamic pituitary axis dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,397,841 I3565F probably damaging Het
Abca13 C A 11: 9,315,416 F3030L probably benign Het
Ak7 A T 12: 105,742,341 I352F probably damaging Het
Alkal2 G T 12: 30,884,851 G23V probably damaging Het
Anapc7 C T 5: 122,428,279 P84S probably benign Het
Apol7a A T 15: 77,389,347 I305N probably damaging Het
Asf1b C T 8: 83,967,930 R108C probably damaging Het
Bicd1 A T 6: 149,520,491 E903D probably benign Het
Bpifb3 A T 2: 153,925,795 I263F probably benign Het
Cavin3 T A 7: 105,481,021 S195C probably damaging Het
Chsy3 C A 18: 59,179,513 R353S probably damaging Het
Col5a2 A G 1: 45,442,730 V78A unknown Het
Cpxm1 C T 2: 130,394,226 E339K probably damaging Het
Cyp26c1 G T 19: 37,687,212 A175S probably benign Het
Dnah5 A T 15: 28,327,343 T2069S probably benign Het
Ednrb A G 14: 103,819,947 F393S probably damaging Het
Fstl4 T C 11: 53,162,675 S385P possibly damaging Het
Gabpb2 G A 3: 95,204,798 S40L probably damaging Het
Hc T A 2: 34,983,719 N1668Y probably benign Het
Kcnh1 A G 1: 192,434,816 H670R probably damaging Het
Krt31 G A 11: 100,047,777 A330V probably benign Het
Lrfn2 T A 17: 49,096,823 M658K possibly damaging Het
Lrrc1 T A 9: 77,457,847 N184I probably damaging Het
Lrrc69 T C 4: 14,795,994 I18V probably benign Het
Lvrn G A 18: 46,850,222 V11M probably damaging Het
Map4k4 T C 1: 40,024,641 S1199P possibly damaging Het
Mib1 T C 18: 10,768,233 probably null Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Myo18b C T 5: 112,760,393 V2005I possibly damaging Het
Myo6 T A 9: 80,254,924 H314Q unknown Het
Nat8f6 A C 6: 85,808,906 M87R probably benign Het
Net1 A G 13: 3,893,458 probably benign Het
Notch4 C T 17: 34,568,254 T294I possibly damaging Het
Nrros A G 16: 32,147,638 L36P probably damaging Het
Olfr25 G C 9: 38,329,935 W113S probably benign Het
Olfr870 T C 9: 20,170,741 M277V probably benign Het
Padi3 T C 4: 140,798,096 H202R probably damaging Het
Pik3ap1 A T 19: 41,328,099 M284K probably damaging Het
Prr27 C A 5: 87,842,851 Y107* probably null Het
Rab5c G T 11: 100,716,783 N188K probably damaging Het
Rlf A T 4: 121,148,335 S1259R probably damaging Het
Rrm2 T C 12: 24,712,752 V298A probably damaging Het
Rtn4rl2 A T 2: 84,880,689 L77H possibly damaging Het
Skint4 A G 4: 112,117,976 I44M probably damaging Het
Spaca7 T C 8: 12,598,998 I164T probably benign Het
Spg7 A G 8: 123,073,829 S153G probably damaging Het
Spink5 T C 18: 43,990,719 S358P probably benign Het
Stx5a T C 19: 8,755,098 M377T unknown Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Ttc41 A G 10: 86,763,980 D1048G probably damaging Het
Ttn A T 2: 76,727,165 W29862R probably damaging Het
Vmn1r203 T G 13: 22,524,984 *312G probably null Het
Vmn2r74 T G 7: 85,952,706 T575P possibly damaging Het
Zfp14 A T 7: 30,039,154 N135K possibly damaging Het
Other mutations in Gabrb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Gabrb1 APN 5 72108446 critical splice donor site probably null
IGL00774:Gabrb1 APN 5 72108446 critical splice donor site probably null
IGL01534:Gabrb1 APN 5 71869429 missense possibly damaging 0.95
IGL02170:Gabrb1 APN 5 72136730 missense probably damaging 1.00
IGL02326:Gabrb1 APN 5 71700847 missense probably damaging 0.99
IGL03278:Gabrb1 APN 5 71869596 missense probably damaging 1.00
IGL03345:Gabrb1 APN 5 72136565 missense possibly damaging 0.53
IGL03050:Gabrb1 UTSW 5 72122154 missense probably benign 0.03
PIT4445001:Gabrb1 UTSW 5 72108782 missense probably damaging 1.00
PIT4515001:Gabrb1 UTSW 5 71700817 missense probably damaging 1.00
R0109:Gabrb1 UTSW 5 72121946 splice site probably benign
R0386:Gabrb1 UTSW 5 72108807 missense probably damaging 0.99
R1512:Gabrb1 UTSW 5 72108704 missense probably damaging 1.00
R1512:Gabrb1 UTSW 5 72108705 missense probably damaging 1.00
R1717:Gabrb1 UTSW 5 72108351 splice site probably null
R1832:Gabrb1 UTSW 5 72121938 splice site probably null
R1961:Gabrb1 UTSW 5 71700336 missense probably benign 0.28
R2363:Gabrb1 UTSW 5 71869573 nonsense probably null
R4686:Gabrb1 UTSW 5 71700022 missense possibly damaging 0.53
R4840:Gabrb1 UTSW 5 71700811 missense probably damaging 1.00
R4916:Gabrb1 UTSW 5 71869421 missense probably damaging 1.00
R4941:Gabrb1 UTSW 5 72136778 missense probably damaging 1.00
R5250:Gabrb1 UTSW 5 71869579 missense possibly damaging 0.80
R5270:Gabrb1 UTSW 5 72108326 missense probably damaging 1.00
R5364:Gabrb1 UTSW 5 72136762 missense probably benign 0.33
R5407:Gabrb1 UTSW 5 72122021 missense possibly damaging 0.90
R5621:Gabrb1 UTSW 5 72108728 missense probably damaging 1.00
R5790:Gabrb1 UTSW 5 72136484 missense possibly damaging 0.53
R6236:Gabrb1 UTSW 5 72108320 missense probably damaging 1.00
R6336:Gabrb1 UTSW 5 72029898 missense possibly damaging 0.72
R7411:Gabrb1 UTSW 5 72122195 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCCAAGAAGCTTCTAAATTTTCAGC -3'
(R):5'- CTAGGGAAAATGTCACTAACTGTG -3'

Sequencing Primer
(F):5'- GCCAATTACTAAACATGATTTGGGG -3'
(R):5'- GGTGGCAGCTAAAAAGAACCCC -3'
Posted On2020-09-02