Incidental Mutation 'R8375:Vmn1r203'
ID646644
Institutional Source Beutler Lab
Gene Symbol Vmn1r203
Ensembl Gene ENSMUSG00000069289
Gene Namevomeronasal 1 receptor 203
SynonymsV1rh11
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R8375 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location22518114-22531992 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to G at 22524984 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glycine at position 312 (*312G)
Ref Sequence ENSEMBL: ENSMUSP00000089322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091729] [ENSMUST00000227520] [ENSMUST00000228889]
Predicted Effect probably null
Transcript: ENSMUST00000091729
AA Change: *312G
SMART Domains Protein: ENSMUSP00000089322
Gene: ENSMUSG00000069289
AA Change: *312G

DomainStartEndE-ValueType
transmembrane domain 19 41 N/A INTRINSIC
Pfam:V1R 43 304 5.8e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000227520
AA Change: *312G
Predicted Effect probably null
Transcript: ENSMUST00000228889
AA Change: *312G
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C A 11: 9,315,416 F3030L probably benign Het
Abca13 A T 11: 9,397,841 I3565F probably damaging Het
Ak7 A T 12: 105,742,341 I352F probably damaging Het
Alkal2 G T 12: 30,884,851 G23V probably damaging Het
Anapc7 C T 5: 122,428,279 P84S probably benign Het
Apol7a A T 15: 77,389,347 I305N probably damaging Het
Asf1b C T 8: 83,967,930 R108C probably damaging Het
Bicd1 A T 6: 149,520,491 E903D probably benign Het
Bpifb3 A T 2: 153,925,795 I263F probably benign Het
Cavin3 T A 7: 105,481,021 S195C probably damaging Het
Chsy3 C A 18: 59,179,513 R353S probably damaging Het
Col5a2 A G 1: 45,442,730 V78A unknown Het
Cpxm1 C T 2: 130,394,226 E339K probably damaging Het
Cyp26c1 G T 19: 37,687,212 A175S probably benign Het
Dnah5 A T 15: 28,327,343 T2069S probably benign Het
Ednrb A G 14: 103,819,947 F393S probably damaging Het
Fstl4 T C 11: 53,162,675 S385P possibly damaging Het
Gabpb2 G A 3: 95,204,798 S40L probably damaging Het
Gabrb1 T C 5: 72,029,829 I155T probably damaging Het
Hc T A 2: 34,983,719 N1668Y probably benign Het
Kcnh1 A G 1: 192,434,816 H670R probably damaging Het
Krt31 G A 11: 100,047,777 A330V probably benign Het
Lrfn2 T A 17: 49,096,823 M658K possibly damaging Het
Lrrc1 T A 9: 77,457,847 N184I probably damaging Het
Lrrc69 T C 4: 14,795,994 I18V probably benign Het
Lvrn G A 18: 46,850,222 V11M probably damaging Het
Map4k4 T C 1: 40,024,641 S1199P possibly damaging Het
Mib1 T C 18: 10,768,233 probably null Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Myo18b C T 5: 112,760,393 V2005I possibly damaging Het
Myo6 T A 9: 80,254,924 H314Q unknown Het
Nat8f6 A C 6: 85,808,906 M87R probably benign Het
Net1 A G 13: 3,893,458 probably benign Het
Notch4 C T 17: 34,568,254 T294I possibly damaging Het
Nrros A G 16: 32,147,638 L36P probably damaging Het
Olfr25 G C 9: 38,329,935 W113S probably benign Het
Olfr870 T C 9: 20,170,741 M277V probably benign Het
Padi3 T C 4: 140,798,096 H202R probably damaging Het
Pik3ap1 A T 19: 41,328,099 M284K probably damaging Het
Prr27 C A 5: 87,842,851 Y107* probably null Het
Rab5c G T 11: 100,716,783 N188K probably damaging Het
Rlf A T 4: 121,148,335 S1259R probably damaging Het
Rrm2 T C 12: 24,712,752 V298A probably damaging Het
Rtn4rl2 A T 2: 84,880,689 L77H possibly damaging Het
Skint4 A G 4: 112,117,976 I44M probably damaging Het
Spaca7 T C 8: 12,598,998 I164T probably benign Het
Spg7 A G 8: 123,073,829 S153G probably damaging Het
Spink5 T C 18: 43,990,719 S358P probably benign Het
Stx5a T C 19: 8,755,098 M377T unknown Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Ttc41 A G 10: 86,763,980 D1048G probably damaging Het
Ttn A T 2: 76,727,165 W29862R probably damaging Het
Vmn2r74 T G 7: 85,952,706 T575P possibly damaging Het
Zfp14 A T 7: 30,039,154 N135K possibly damaging Het
Other mutations in Vmn1r203
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Vmn1r203 APN 13 22524777 missense probably damaging 1.00
IGL01527:Vmn1r203 APN 13 22524277 missense possibly damaging 0.89
IGL01808:Vmn1r203 APN 13 22524547 missense probably benign 0.02
IGL01887:Vmn1r203 APN 13 22524876 missense probably benign 0.00
IGL02340:Vmn1r203 APN 13 22524827 nonsense probably null
IGL02543:Vmn1r203 APN 13 22524904 missense probably damaging 1.00
IGL02684:Vmn1r203 APN 13 22524369 missense possibly damaging 0.95
BB005:Vmn1r203 UTSW 13 22524535 missense probably benign 0.01
BB015:Vmn1r203 UTSW 13 22524535 missense probably benign 0.01
PIT4519001:Vmn1r203 UTSW 13 22524595 missense probably benign 0.01
R0544:Vmn1r203 UTSW 13 22524273 missense possibly damaging 0.94
R1365:Vmn1r203 UTSW 13 22524586 missense probably benign 0.00
R1396:Vmn1r203 UTSW 13 22524508 missense probably benign 0.01
R1794:Vmn1r203 UTSW 13 22524351 missense probably damaging 1.00
R2010:Vmn1r203 UTSW 13 22524447 missense possibly damaging 0.56
R2169:Vmn1r203 UTSW 13 22524735 nonsense probably null
R2333:Vmn1r203 UTSW 13 22524943 missense probably damaging 1.00
R2418:Vmn1r203 UTSW 13 22524834 missense possibly damaging 0.57
R2419:Vmn1r203 UTSW 13 22524834 missense possibly damaging 0.57
R4322:Vmn1r203 UTSW 13 22524238 missense probably damaging 1.00
R4460:Vmn1r203 UTSW 13 22524682 missense probably damaging 0.98
R4686:Vmn1r203 UTSW 13 22524358 missense probably damaging 1.00
R5526:Vmn1r203 UTSW 13 22524103 missense probably benign 0.01
R6240:Vmn1r203 UTSW 13 22524729 missense possibly damaging 0.89
R6607:Vmn1r203 UTSW 13 22524721 missense probably benign 0.23
R7575:Vmn1r203 UTSW 13 22524418 missense probably benign 0.12
R7928:Vmn1r203 UTSW 13 22524535 missense probably benign 0.01
R8421:Vmn1r203 UTSW 13 22524984 makesense probably null
R8424:Vmn1r203 UTSW 13 22524834 missense probably damaging 1.00
Z1177:Vmn1r203 UTSW 13 22524409 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGCTGCTCAAAGTGTCTTCC -3'
(R):5'- CCATTTAAAAGAGTGGCAAATCGAG -3'

Sequencing Primer
(F):5'- GCTCAAAGTGTCTTCCTTCTGATG -3'
(R):5'- TGGCAAATCGAGAATGAGATGTC -3'
Posted On2020-09-02