Incidental Mutation 'R8375:Ednrb'
ID 646645
Institutional Source Beutler Lab
Gene Symbol Ednrb
Ensembl Gene ENSMUSG00000022122
Gene Name endothelin receptor type B
Synonyms ETR-b, Sox10m1, ETb
MMRRC Submission 067743-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.716) question?
Stock # R8375 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 104052061-104081838 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104057383 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 393 (F393S)
Ref Sequence ENSEMBL: ENSMUSP00000022718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022718] [ENSMUST00000172237] [ENSMUST00000227824]
AlphaFold P48302
Predicted Effect probably damaging
Transcript: ENSMUST00000022718
AA Change: F393S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022718
Gene: ENSMUSG00000022122
AA Change: F393S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 109 329 2.3e-6 PFAM
Pfam:7TM_GPCR_Srsx 112 401 7.3e-11 PFAM
Pfam:7tm_1 118 387 8.5e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172237
AA Change: F393S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126057
Gene: ENSMUSG00000022122
AA Change: F393S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 109 328 1.9e-6 PFAM
Pfam:7TM_GPCR_Srsx 112 401 7.3e-11 PFAM
Pfam:7tm_1 118 387 4.2e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227824
AA Change: F393S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the G-protein coupled receptor family. It encodes a receptor for endothelins, peptides that are involved in vasocontriction. The encoded protein activates a phosphatidylinositol-calcium second messenger system and is required for the development of enteric neurons and melanocytes. Gene disruption causes pigmentation anomalies, deafness, and abnormal dilation of the colon due to defects of neural crest-derived cells. Mutations in this gene are found in the piebald mouse, and mouse models of Hirschsprung's disease and Waardenburg syndrome type 4. Renal collecting duct-specific gene deletion causes sodium retention and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for null mutations have pigmentation limited to small patches on the head and rump and die from megacolon resulting from impaired neural crest migration and aganglionosis. Heterozygotes for a null allele show improved cardiac tolerance to hypoxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C A 11: 9,265,416 (GRCm39) F3030L probably benign Het
Abca13 A T 11: 9,347,841 (GRCm39) I3565F probably damaging Het
Ak7 A T 12: 105,708,600 (GRCm39) I352F probably damaging Het
Alkal2 G T 12: 30,934,850 (GRCm39) G23V probably damaging Het
Anapc7 C T 5: 122,566,342 (GRCm39) P84S probably benign Het
Apol7a A T 15: 77,273,547 (GRCm39) I305N probably damaging Het
Asf1b C T 8: 84,694,559 (GRCm39) R108C probably damaging Het
Bicd1 A T 6: 149,421,989 (GRCm39) E903D probably benign Het
Bpifb3 A T 2: 153,767,715 (GRCm39) I263F probably benign Het
Cavin3 T A 7: 105,130,228 (GRCm39) S195C probably damaging Het
Chsy3 C A 18: 59,312,585 (GRCm39) R353S probably damaging Het
Col5a2 A G 1: 45,481,890 (GRCm39) V78A unknown Het
Cpxm1 C T 2: 130,236,146 (GRCm39) E339K probably damaging Het
Cyp26c1 G T 19: 37,675,660 (GRCm39) A175S probably benign Het
Dnah5 A T 15: 28,327,489 (GRCm39) T2069S probably benign Het
Fstl4 T C 11: 53,053,502 (GRCm39) S385P possibly damaging Het
Gabpb2 G A 3: 95,112,109 (GRCm39) S40L probably damaging Het
Gabrb1 T C 5: 72,187,172 (GRCm39) I155T probably damaging Het
Hc T A 2: 34,873,731 (GRCm39) N1668Y probably benign Het
Kcnh1 A G 1: 192,117,124 (GRCm39) H670R probably damaging Het
Krt31 G A 11: 99,938,603 (GRCm39) A330V probably benign Het
Lrfn2 T A 17: 49,403,851 (GRCm39) M658K possibly damaging Het
Lrrc1 T A 9: 77,365,129 (GRCm39) N184I probably damaging Het
Lrrc69 T C 4: 14,795,994 (GRCm39) I18V probably benign Het
Lvrn G A 18: 46,983,289 (GRCm39) V11M probably damaging Het
Map4k4 T C 1: 40,063,801 (GRCm39) S1199P possibly damaging Het
Mib1 T C 18: 10,768,233 (GRCm39) probably null Het
Mpv17l A T 16: 13,758,863 (GRCm39) I96L probably benign Het
Myo18b C T 5: 112,908,259 (GRCm39) V2005I possibly damaging Het
Myo6 T A 9: 80,162,206 (GRCm39) H314Q unknown Het
Nat8f6 A C 6: 85,785,888 (GRCm39) M87R probably benign Het
Net1 A G 13: 3,943,458 (GRCm39) probably benign Het
Notch4 C T 17: 34,787,228 (GRCm39) T294I possibly damaging Het
Nrros A G 16: 31,966,456 (GRCm39) L36P probably damaging Het
Or8b12i T C 9: 20,082,037 (GRCm39) M277V probably benign Het
Or8c9 G C 9: 38,241,231 (GRCm39) W113S probably benign Het
Padi3 T C 4: 140,525,407 (GRCm39) H202R probably damaging Het
Pik3ap1 A T 19: 41,316,538 (GRCm39) M284K probably damaging Het
Prr27 C A 5: 87,990,710 (GRCm39) Y107* probably null Het
Rab5c G T 11: 100,607,609 (GRCm39) N188K probably damaging Het
Rlf A T 4: 121,005,532 (GRCm39) S1259R probably damaging Het
Rrm2 T C 12: 24,762,751 (GRCm39) V298A probably damaging Het
Rtn4rl2 A T 2: 84,711,033 (GRCm39) L77H possibly damaging Het
Skint4 A G 4: 111,975,173 (GRCm39) I44M probably damaging Het
Spaca7 T C 8: 12,648,998 (GRCm39) I164T probably benign Het
Spg7 A G 8: 123,800,568 (GRCm39) S153G probably damaging Het
Spink5 T C 18: 44,123,786 (GRCm39) S358P probably benign Het
Stx5a T C 19: 8,732,462 (GRCm39) M377T unknown Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,354,015 (GRCm39) probably benign Het
Ttc41 A G 10: 86,599,844 (GRCm39) D1048G probably damaging Het
Ttn A T 2: 76,557,509 (GRCm39) W29862R probably damaging Het
Vmn1r203 T G 13: 22,709,154 (GRCm39) *312G probably null Het
Vmn2r74 T G 7: 85,601,914 (GRCm39) T575P possibly damaging Het
Zfp14 A T 7: 29,738,579 (GRCm39) N135K possibly damaging Het
Other mutations in Ednrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Ednrb APN 14 104,057,455 (GRCm39) missense probably damaging 1.00
IGL01433:Ednrb APN 14 104,080,626 (GRCm39) missense probably damaging 0.98
IGL01631:Ednrb APN 14 104,080,661 (GRCm39) missense probably benign 0.02
IGL01696:Ednrb APN 14 104,060,625 (GRCm39) missense probably benign 0.00
IGL01974:Ednrb APN 14 104,058,254 (GRCm39) missense probably damaging 1.00
IGL02749:Ednrb APN 14 104,060,495 (GRCm39) missense possibly damaging 0.63
IGL03277:Ednrb APN 14 104,080,735 (GRCm39) missense probably benign 0.00
gus-gus UTSW 14 104,057,449 (GRCm39) missense probably damaging 1.00
pongo UTSW 14 104,060,710 (GRCm39) splice site probably null
sposh UTSW 14 104,059,150 (GRCm39) missense probably damaging 0.97
R0284:Ednrb UTSW 14 104,057,449 (GRCm39) missense probably damaging 1.00
R0591:Ednrb UTSW 14 104,060,710 (GRCm39) splice site probably null
R2072:Ednrb UTSW 14 104,054,535 (GRCm39) missense probably benign 0.27
R2080:Ednrb UTSW 14 104,080,536 (GRCm39) missense probably damaging 1.00
R2102:Ednrb UTSW 14 104,058,350 (GRCm39) nonsense probably null
R2118:Ednrb UTSW 14 104,059,204 (GRCm39) missense probably benign 0.42
R2119:Ednrb UTSW 14 104,059,204 (GRCm39) missense probably benign 0.42
R2124:Ednrb UTSW 14 104,059,204 (GRCm39) missense probably benign 0.42
R2851:Ednrb UTSW 14 104,059,110 (GRCm39) missense probably benign 0.04
R2852:Ednrb UTSW 14 104,059,110 (GRCm39) missense probably benign 0.04
R3708:Ednrb UTSW 14 104,054,516 (GRCm39) missense probably damaging 1.00
R4887:Ednrb UTSW 14 104,057,447 (GRCm39) missense possibly damaging 0.95
R5626:Ednrb UTSW 14 104,080,564 (GRCm39) missense probably damaging 0.98
R5688:Ednrb UTSW 14 104,060,831 (GRCm39) missense probably damaging 1.00
R5802:Ednrb UTSW 14 104,059,150 (GRCm39) missense probably damaging 0.97
R5834:Ednrb UTSW 14 104,058,313 (GRCm39) missense probably damaging 1.00
R7212:Ednrb UTSW 14 104,080,444 (GRCm39) missense probably damaging 0.96
R7368:Ednrb UTSW 14 104,057,453 (GRCm39) missense probably benign 0.01
R7766:Ednrb UTSW 14 104,080,725 (GRCm39) missense probably benign 0.12
R7866:Ednrb UTSW 14 104,080,738 (GRCm39) missense probably benign
R8170:Ednrb UTSW 14 104,060,640 (GRCm39) missense possibly damaging 0.92
R8220:Ednrb UTSW 14 104,059,141 (GRCm39) missense probably damaging 1.00
R8299:Ednrb UTSW 14 104,060,936 (GRCm39) missense probably damaging 1.00
R8431:Ednrb UTSW 14 104,080,633 (GRCm39) missense probably benign 0.00
R9035:Ednrb UTSW 14 104,080,665 (GRCm39) missense probably benign 0.00
R9128:Ednrb UTSW 14 104,080,528 (GRCm39) missense probably damaging 1.00
R9546:Ednrb UTSW 14 104,080,459 (GRCm39) missense probably benign
R9547:Ednrb UTSW 14 104,080,459 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCATGGCTTACTATTGTCAAGG -3'
(R):5'- CCTCTGCTGGTAAATCAGTGGC -3'

Sequencing Primer
(F):5'- GGTGGCATGCATCTTTAATCCCAG -3'
(R):5'- GTGATTTGGGCTTTCTTCATAAAAAC -3'
Posted On 2020-09-02