Incidental Mutation 'R8376:Nbea'
ID 646666
Institutional Source Beutler Lab
Gene Symbol Nbea
Ensembl Gene ENSMUSG00000027799
Gene Name neurobeachin
Synonyms
MMRRC Submission 067744-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8376 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 55532616-56091122 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 55551076 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 2696 (S2696L)
Ref Sequence ENSEMBL: ENSMUSP00000029374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029374]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000029374
AA Change: S2696L

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029374
Gene: ENSMUSG00000027799
AA Change: S2696L

DomainStartEndE-ValueType
low complexity region 19 40 N/A INTRINSIC
Pfam:Laminin_G_3 228 393 2.8e-13 PFAM
Pfam:DUF4704 462 733 4e-113 PFAM
low complexity region 792 802 N/A INTRINSIC
low complexity region 964 969 N/A INTRINSIC
low complexity region 1781 1790 N/A INTRINSIC
low complexity region 1791 1807 N/A INTRINSIC
low complexity region 1835 1845 N/A INTRINSIC
Pfam:DUF1088 1956 2122 3.5e-91 PFAM
Pfam:PH_BEACH 2148 2245 2.6e-32 PFAM
Beach 2276 2553 1.3e-205 SMART
WD40 2659 2696 2.12e2 SMART
WD40 2699 2742 2.22e0 SMART
WD40 2759 2798 9.21e0 SMART
WD40 2842 2880 2.88e-1 SMART
WD40 2883 2922 8.91e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large, diverse group of A-kinase anchor proteins that target the activity of protein kinase A to specific subcellular sites by binding to its type II regulatory subunits. Brain-specific expression and coat protein-like membrane recruitment of a highly similar protein in mouse suggest an involvement in neuronal post-Golgi membrane traffic. Mutations in this gene may be associated with a form of autism. This gene and its expression are frequently disrupted in patients with multiple myeloma. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants may exist, but their full-length nature has not been determined.[provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele or transgene insertion die shortly after birth, are cyanotic, and exhibit no response to tactile stimuli, no spontaneous movement, and impaired CNS synaptic transmission. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(3) Transgenic(1)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A C 8: 25,409,936 (GRCm39) I173S possibly damaging Het
Ahctf1 T C 1: 179,610,520 (GRCm39) D599G probably damaging Het
Alkal2 G T 12: 30,934,850 (GRCm39) G23V probably damaging Het
Ankrd40 G T 11: 94,225,662 (GRCm39) G231V probably damaging Het
Apba2 T A 7: 64,345,341 (GRCm39) V177D probably benign Het
Atp12a G T 14: 56,612,083 (GRCm39) probably null Het
Birc6 C T 17: 74,896,635 (GRCm39) T1027M probably benign Het
Bmpr2 G A 1: 59,906,515 (GRCm39) R536H probably damaging Het
Brms1l C A 12: 55,888,414 (GRCm39) N67K probably benign Het
Cachd1 G A 4: 100,832,073 (GRCm39) R745H probably damaging Het
Cacnb4 G A 2: 52,354,665 (GRCm39) Q238* probably null Het
Cdc42 G A 4: 137,056,205 (GRCm39) T102I probably benign Het
Cfhr1 A C 1: 139,475,549 (GRCm39) C307W unknown Het
Ddb1 G A 19: 10,596,669 (GRCm39) V463M probably damaging Het
Dhx30 G A 9: 109,917,707 (GRCm39) R365C probably benign Het
Dnah1 A G 14: 31,023,303 (GRCm39) F1005L probably damaging Het
Elp4 A G 2: 105,672,653 (GRCm39) V144A probably benign Het
Enpp2 T A 15: 54,773,491 (GRCm39) N77Y probably damaging Het
Fsip1 C T 2: 118,063,519 (GRCm39) V317I possibly damaging Het
Gc G A 5: 89,586,118 (GRCm39) Q341* probably null Het
Gpt2 A T 8: 86,219,694 (GRCm39) I47F probably benign Het
Ino80 A T 2: 119,272,968 (GRCm39) S503T probably benign Het
Kcnn4 C A 7: 24,077,051 (GRCm39) T200K possibly damaging Het
Krtap4-7 A G 11: 99,534,753 (GRCm39) S37P unknown Het
Lrrc4b T C 7: 44,112,018 (GRCm39) V630A probably benign Het
Man2a2 C T 7: 80,010,671 (GRCm39) W773* probably null Het
Mgrn1 T A 16: 4,733,630 (GRCm39) L192Q probably damaging Het
Mtx1 A G 3: 89,121,478 (GRCm39) V52A probably benign Het
Myc A T 15: 61,859,395 (GRCm39) N24Y possibly damaging Het
Nox4 A G 7: 87,023,592 (GRCm39) N493D probably damaging Het
Or52w1 C A 7: 105,017,847 (GRCm39) P105T probably benign Het
Osbpl10 G A 9: 115,052,661 (GRCm39) G403D probably damaging Het
Pdcd6ip A T 9: 113,518,684 (GRCm39) L192Q probably damaging Het
Pde3a A G 6: 141,426,947 (GRCm39) I703V possibly damaging Het
Phf8-ps C A 17: 33,286,038 (GRCm39) A255S probably benign Het
Pkd1l3 CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA 8: 110,350,420 (GRCm39) probably benign Het
Plcb3 A G 19: 6,944,071 (GRCm39) S36P probably damaging Het
Plk5 T C 10: 80,196,179 (GRCm39) F279L probably damaging Het
Prl7a1 T G 13: 27,821,638 (GRCm39) E99D probably benign Het
Rnf4 C T 5: 34,508,701 (GRCm39) R188W probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGAGGCGGCGG 7: 97,229,124 (GRCm39) probably benign Het
Scel A G 14: 103,809,451 (GRCm39) S264G probably benign Het
Sdk1 A G 5: 142,144,376 (GRCm39) Q1712R possibly damaging Het
Slc15a1 A G 14: 121,718,115 (GRCm39) Y255H probably benign Het
Syne1 C T 10: 4,993,615 (GRCm39) G525D probably benign Het
Taldo1 T C 7: 140,981,788 (GRCm39) V214A probably damaging Het
Tbc1d12 A G 19: 38,889,853 (GRCm39) T428A probably damaging Het
Tlr6 T C 5: 65,112,455 (GRCm39) K151E probably benign Het
Ubr2 T A 17: 47,253,721 (GRCm39) D1468V probably benign Het
Ubtf A C 11: 102,199,737 (GRCm39) Y463D probably damaging Het
Uroc1 A T 6: 90,314,697 (GRCm39) M106L probably damaging Het
Vmn1r55 T A 7: 5,149,869 (GRCm39) I185L probably benign Het
Vmn2r93 T A 17: 18,525,230 (GRCm39) V296D probably damaging Het
Zfp65 A C 13: 67,857,037 (GRCm39) Y81D probably damaging Het
Zw10 A T 9: 48,988,783 (GRCm39) Y683F possibly damaging Het
Other mutations in Nbea
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Nbea APN 3 55,535,914 (GRCm39) missense probably damaging 1.00
IGL00541:Nbea APN 3 55,875,510 (GRCm39) missense probably benign 0.02
IGL00584:Nbea APN 3 55,989,869 (GRCm39) missense probably damaging 0.98
IGL00648:Nbea APN 3 55,916,681 (GRCm39) missense probably damaging 0.98
IGL00785:Nbea APN 3 55,862,814 (GRCm39) missense probably benign
IGL00899:Nbea APN 3 55,550,266 (GRCm39) missense probably benign 0.32
IGL00955:Nbea APN 3 55,912,893 (GRCm39) missense possibly damaging 0.45
IGL01296:Nbea APN 3 55,938,957 (GRCm39) missense probably benign 0.04
IGL01299:Nbea APN 3 55,598,315 (GRCm39) missense probably damaging 1.00
IGL01393:Nbea APN 3 55,912,729 (GRCm39) missense probably benign 0.02
IGL01550:Nbea APN 3 55,712,669 (GRCm39) missense possibly damaging 0.93
IGL02023:Nbea APN 3 55,588,437 (GRCm39) missense probably damaging 1.00
IGL02034:Nbea APN 3 55,875,577 (GRCm39) missense probably damaging 1.00
IGL02061:Nbea APN 3 55,625,308 (GRCm39) missense possibly damaging 0.54
IGL02082:Nbea APN 3 55,875,588 (GRCm39) missense possibly damaging 0.88
IGL02113:Nbea APN 3 55,899,913 (GRCm39) missense probably benign
IGL02188:Nbea APN 3 55,891,258 (GRCm39) missense probably benign 0.00
IGL02319:Nbea APN 3 55,893,159 (GRCm39) missense probably damaging 1.00
IGL02406:Nbea APN 3 55,993,687 (GRCm39) missense probably benign 0.02
IGL02494:Nbea APN 3 55,712,772 (GRCm39) missense probably benign 0.02
IGL02550:Nbea APN 3 55,926,835 (GRCm39) missense probably damaging 0.98
IGL02706:Nbea APN 3 55,944,699 (GRCm39) missense probably damaging 1.00
IGL02718:Nbea APN 3 55,539,483 (GRCm39) nonsense probably null
IGL02822:Nbea APN 3 55,926,868 (GRCm39) missense possibly damaging 0.93
IGL02885:Nbea APN 3 55,539,407 (GRCm39) missense probably benign 0.01
IGL03000:Nbea APN 3 55,912,048 (GRCm39) missense possibly damaging 0.94
IGL03081:Nbea APN 3 55,987,339 (GRCm39) missense probably damaging 1.00
IGL03091:Nbea APN 3 55,992,725 (GRCm39) missense probably damaging 1.00
IGL03368:Nbea APN 3 55,987,351 (GRCm39) missense probably damaging 0.98
Neches UTSW 3 55,860,455 (GRCm39) critical splice donor site probably null
scotland UTSW 3 55,534,329 (GRCm39) missense probably damaging 1.00
Wales UTSW 3 55,998,540 (GRCm39) missense probably damaging 1.00
FR4340:Nbea UTSW 3 55,916,633 (GRCm39) critical splice donor site probably benign
G4846:Nbea UTSW 3 55,994,918 (GRCm39) missense probably damaging 0.98
IGL02835:Nbea UTSW 3 55,625,290 (GRCm39) missense possibly damaging 0.88
LCD18:Nbea UTSW 3 55,608,948 (GRCm39) intron probably benign
R0087:Nbea UTSW 3 55,998,444 (GRCm39) missense possibly damaging 0.92
R0220:Nbea UTSW 3 55,912,724 (GRCm39) missense probably benign 0.30
R0324:Nbea UTSW 3 55,965,369 (GRCm39) critical splice donor site probably null
R0330:Nbea UTSW 3 55,550,238 (GRCm39) missense probably benign 0.27
R0391:Nbea UTSW 3 55,944,698 (GRCm39) missense probably damaging 1.00
R0394:Nbea UTSW 3 55,937,328 (GRCm39) missense probably damaging 1.00
R0419:Nbea UTSW 3 55,726,715 (GRCm39) missense probably benign 0.05
R0503:Nbea UTSW 3 55,550,257 (GRCm39) missense possibly damaging 0.79
R0521:Nbea UTSW 3 55,915,689 (GRCm39) missense probably damaging 1.00
R0595:Nbea UTSW 3 55,535,917 (GRCm39) missense probably benign 0.18
R0894:Nbea UTSW 3 55,916,761 (GRCm39) missense possibly damaging 0.89
R1072:Nbea UTSW 3 55,993,617 (GRCm39) missense possibly damaging 0.94
R1125:Nbea UTSW 3 55,764,427 (GRCm39) nonsense probably null
R1169:Nbea UTSW 3 55,875,744 (GRCm39) missense probably benign 0.00
R1241:Nbea UTSW 3 55,965,461 (GRCm39) missense probably damaging 1.00
R1269:Nbea UTSW 3 55,912,202 (GRCm39) missense probably benign 0.05
R1406:Nbea UTSW 3 55,944,702 (GRCm39) missense probably benign 0.00
R1406:Nbea UTSW 3 55,944,702 (GRCm39) missense probably benign 0.00
R1457:Nbea UTSW 3 55,992,748 (GRCm39) missense probably damaging 1.00
R1482:Nbea UTSW 3 55,987,414 (GRCm39) missense probably damaging 1.00
R1483:Nbea UTSW 3 55,910,211 (GRCm39) missense probably benign 0.25
R1502:Nbea UTSW 3 55,912,310 (GRCm39) missense probably benign 0.03
R1544:Nbea UTSW 3 55,966,248 (GRCm39) missense probably damaging 0.99
R1629:Nbea UTSW 3 55,910,312 (GRCm39) missense possibly damaging 0.52
R1647:Nbea UTSW 3 55,537,650 (GRCm39) missense probably damaging 0.97
R1663:Nbea UTSW 3 55,553,407 (GRCm39) missense possibly damaging 0.95
R1722:Nbea UTSW 3 55,573,116 (GRCm39) missense probably damaging 1.00
R1757:Nbea UTSW 3 55,537,610 (GRCm39) missense possibly damaging 0.83
R1771:Nbea UTSW 3 55,841,940 (GRCm39) missense probably benign 0.00
R1796:Nbea UTSW 3 55,551,129 (GRCm39) missense possibly damaging 0.48
R1844:Nbea UTSW 3 55,989,857 (GRCm39) missense probably damaging 0.97
R1872:Nbea UTSW 3 55,550,310 (GRCm39) missense probably benign 0.12
R1938:Nbea UTSW 3 55,992,743 (GRCm39) missense probably damaging 1.00
R1940:Nbea UTSW 3 55,860,521 (GRCm39) missense possibly damaging 0.78
R2062:Nbea UTSW 3 55,993,578 (GRCm39) splice site probably benign
R2066:Nbea UTSW 3 55,875,567 (GRCm39) missense probably damaging 1.00
R2097:Nbea UTSW 3 55,630,638 (GRCm39) missense probably damaging 0.96
R2181:Nbea UTSW 3 55,937,360 (GRCm39) missense possibly damaging 0.92
R2274:Nbea UTSW 3 55,895,506 (GRCm39) splice site probably null
R2345:Nbea UTSW 3 55,992,700 (GRCm39) missense probably damaging 1.00
R2423:Nbea UTSW 3 55,992,727 (GRCm39) missense probably damaging 1.00
R2434:Nbea UTSW 3 55,554,881 (GRCm39) missense possibly damaging 0.91
R2880:Nbea UTSW 3 55,554,779 (GRCm39) missense probably benign 0.04
R2881:Nbea UTSW 3 55,554,779 (GRCm39) missense probably benign 0.04
R2940:Nbea UTSW 3 55,842,045 (GRCm39) missense probably benign 0.24
R3500:Nbea UTSW 3 55,588,431 (GRCm39) missense possibly damaging 0.88
R3765:Nbea UTSW 3 55,912,970 (GRCm39) missense probably damaging 1.00
R3790:Nbea UTSW 3 55,912,450 (GRCm39) missense probably benign
R3808:Nbea UTSW 3 55,625,269 (GRCm39) missense probably benign 0.02
R3845:Nbea UTSW 3 55,993,713 (GRCm39) splice site probably benign
R4182:Nbea UTSW 3 55,915,848 (GRCm39) missense probably damaging 0.99
R4385:Nbea UTSW 3 55,908,059 (GRCm39) missense possibly damaging 0.77
R4419:Nbea UTSW 3 55,917,021 (GRCm39) missense probably damaging 1.00
R4426:Nbea UTSW 3 55,989,800 (GRCm39) missense probably damaging 0.98
R4451:Nbea UTSW 3 55,899,753 (GRCm39) critical splice donor site probably null
R4456:Nbea UTSW 3 55,551,205 (GRCm39) missense probably benign 0.00
R4604:Nbea UTSW 3 55,631,069 (GRCm39) missense probably benign 0.18
R4687:Nbea UTSW 3 55,965,486 (GRCm39) missense probably damaging 1.00
R4758:Nbea UTSW 3 55,912,824 (GRCm39) missense probably benign
R4840:Nbea UTSW 3 55,618,091 (GRCm39) missense probably benign 0.37
R4888:Nbea UTSW 3 55,912,776 (GRCm39) missense possibly damaging 0.61
R4954:Nbea UTSW 3 55,943,379 (GRCm39) missense probably damaging 1.00
R4972:Nbea UTSW 3 55,992,667 (GRCm39) missense probably damaging 0.99
R4980:Nbea UTSW 3 55,860,466 (GRCm39) missense probably benign 0.00
R4980:Nbea UTSW 3 55,554,772 (GRCm39) splice site probably null
R5104:Nbea UTSW 3 55,987,348 (GRCm39) missense probably damaging 1.00
R5139:Nbea UTSW 3 55,534,384 (GRCm39) missense possibly damaging 0.90
R5166:Nbea UTSW 3 55,926,874 (GRCm39) missense probably damaging 1.00
R5347:Nbea UTSW 3 55,948,297 (GRCm39) missense probably damaging 1.00
R5350:Nbea UTSW 3 55,926,845 (GRCm39) missense probably damaging 1.00
R5418:Nbea UTSW 3 55,553,410 (GRCm39) missense possibly damaging 0.86
R5586:Nbea UTSW 3 55,539,392 (GRCm39) missense probably benign 0.08
R5627:Nbea UTSW 3 55,899,766 (GRCm39) missense probably damaging 1.00
R5683:Nbea UTSW 3 55,536,007 (GRCm39) missense possibly damaging 0.53
R5765:Nbea UTSW 3 55,912,719 (GRCm39) missense probably benign 0.15
R5853:Nbea UTSW 3 55,899,822 (GRCm39) missense probably damaging 1.00
R5858:Nbea UTSW 3 55,860,455 (GRCm39) critical splice donor site probably null
R5955:Nbea UTSW 3 55,588,404 (GRCm39) missense probably benign 0.00
R5976:Nbea UTSW 3 55,761,268 (GRCm39) missense probably benign 0.30
R6039:Nbea UTSW 3 55,912,538 (GRCm39) missense probably benign 0.00
R6039:Nbea UTSW 3 55,912,538 (GRCm39) missense probably benign 0.00
R6043:Nbea UTSW 3 55,693,896 (GRCm39) missense probably benign 0.32
R6122:Nbea UTSW 3 55,937,317 (GRCm39) missense probably damaging 1.00
R6218:Nbea UTSW 3 55,535,905 (GRCm39) missense probably damaging 0.97
R6331:Nbea UTSW 3 55,908,037 (GRCm39) missense possibly damaging 0.94
R6334:Nbea UTSW 3 55,944,570 (GRCm39) missense probably damaging 1.00
R6393:Nbea UTSW 3 55,998,540 (GRCm39) missense probably damaging 1.00
R6411:Nbea UTSW 3 55,712,778 (GRCm39) missense probably benign 0.01
R6457:Nbea UTSW 3 55,907,990 (GRCm39) missense probably damaging 1.00
R6476:Nbea UTSW 3 55,912,227 (GRCm39) missense probably benign 0.00
R6488:Nbea UTSW 3 55,625,264 (GRCm39) missense probably damaging 0.99
R6700:Nbea UTSW 3 55,989,869 (GRCm39) missense possibly damaging 0.89
R6702:Nbea UTSW 3 55,912,923 (GRCm39) missense probably benign 0.06
R6752:Nbea UTSW 3 55,944,640 (GRCm39) missense probably benign
R6752:Nbea UTSW 3 55,875,730 (GRCm39) missense probably benign 0.02
R6804:Nbea UTSW 3 55,994,874 (GRCm39) missense probably benign 0.37
R6901:Nbea UTSW 3 55,926,836 (GRCm39) missense probably damaging 1.00
R6933:Nbea UTSW 3 55,631,031 (GRCm39) missense possibly damaging 0.63
R7124:Nbea UTSW 3 55,899,865 (GRCm39) missense probably damaging 1.00
R7211:Nbea UTSW 3 55,912,322 (GRCm39) missense probably benign 0.05
R7308:Nbea UTSW 3 55,998,452 (GRCm39) missense probably damaging 1.00
R7405:Nbea UTSW 3 55,712,687 (GRCm39) missense possibly damaging 0.94
R7669:Nbea UTSW 3 55,625,200 (GRCm39) missense probably damaging 1.00
R7762:Nbea UTSW 3 55,557,126 (GRCm39) missense probably damaging 1.00
R7833:Nbea UTSW 3 55,910,218 (GRCm39) missense probably damaging 1.00
R7885:Nbea UTSW 3 55,573,110 (GRCm39) missense probably damaging 0.97
R7935:Nbea UTSW 3 55,966,086 (GRCm39) missense probably damaging 1.00
R8050:Nbea UTSW 3 55,895,402 (GRCm39) missense probably damaging 0.99
R8108:Nbea UTSW 3 55,726,736 (GRCm39) missense probably benign 0.11
R8290:Nbea UTSW 3 55,966,056 (GRCm39) nonsense probably null
R8314:Nbea UTSW 3 55,916,672 (GRCm39) missense probably damaging 0.99
R8321:Nbea UTSW 3 56,090,518 (GRCm39) missense possibly damaging 0.86
R8410:Nbea UTSW 3 55,944,684 (GRCm39) missense probably damaging 1.00
R8556:Nbea UTSW 3 55,554,807 (GRCm39) missense probably benign 0.25
R8753:Nbea UTSW 3 55,534,329 (GRCm39) missense probably damaging 1.00
R8844:Nbea UTSW 3 55,998,415 (GRCm39) missense probably damaging 0.97
R8884:Nbea UTSW 3 55,712,720 (GRCm39) missense probably benign 0.00
R8886:Nbea UTSW 3 55,966,148 (GRCm39) missense probably damaging 1.00
R8890:Nbea UTSW 3 55,926,784 (GRCm39) splice site probably benign
R9004:Nbea UTSW 3 55,910,359 (GRCm39) missense probably benign 0.01
R9022:Nbea UTSW 3 55,551,110 (GRCm39) missense possibly damaging 0.79
R9080:Nbea UTSW 3 55,912,516 (GRCm39) nonsense probably null
R9087:Nbea UTSW 3 55,550,157 (GRCm39) critical splice donor site probably null
R9104:Nbea UTSW 3 55,862,809 (GRCm39) missense probably benign
R9165:Nbea UTSW 3 55,912,289 (GRCm39) missense probably benign 0.15
R9219:Nbea UTSW 3 55,998,393 (GRCm39) frame shift probably null
R9221:Nbea UTSW 3 55,998,393 (GRCm39) frame shift probably null
R9222:Nbea UTSW 3 55,998,393 (GRCm39) frame shift probably null
R9260:Nbea UTSW 3 55,891,233 (GRCm39) missense possibly damaging 0.50
R9263:Nbea UTSW 3 55,998,393 (GRCm39) frame shift probably null
R9265:Nbea UTSW 3 55,998,393 (GRCm39) frame shift probably null
R9294:Nbea UTSW 3 55,998,513 (GRCm39) missense probably benign 0.00
R9360:Nbea UTSW 3 55,943,319 (GRCm39) missense possibly damaging 0.96
R9387:Nbea UTSW 3 55,898,460 (GRCm39) missense probably benign 0.12
R9428:Nbea UTSW 3 55,998,393 (GRCm39) frame shift probably null
R9435:Nbea UTSW 3 55,943,309 (GRCm39) missense possibly damaging 0.63
R9507:Nbea UTSW 3 55,573,011 (GRCm39) missense probably damaging 1.00
R9514:Nbea UTSW 3 55,937,366 (GRCm39) missense probably damaging 1.00
R9516:Nbea UTSW 3 55,937,366 (GRCm39) missense probably damaging 1.00
R9674:Nbea UTSW 3 55,966,183 (GRCm39) missense probably damaging 1.00
R9688:Nbea UTSW 3 55,557,165 (GRCm39) missense probably benign 0.42
R9709:Nbea UTSW 3 55,693,879 (GRCm39) nonsense probably null
RF051:Nbea UTSW 3 55,916,633 (GRCm39) critical splice donor site probably benign
X0018:Nbea UTSW 3 55,943,469 (GRCm39) missense probably benign 0.39
Z1088:Nbea UTSW 3 55,630,584 (GRCm39) missense probably benign 0.34
Z1177:Nbea UTSW 3 55,938,971 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCGGAGAGGATGCACTC -3'
(R):5'- ACTAGGGCATAACGAAACTCTTCTG -3'

Sequencing Primer
(F):5'- TCGCAGAATCTAGAGCTTGC -3'
(R):5'- ACGAAACTCTTCTGTTTGTTTTTAGC -3'
Posted On 2020-09-02