Incidental Mutation 'R8376:Man2a2'
ID646680
Institutional Source Beutler Lab
Gene Symbol Man2a2
Ensembl Gene ENSMUSG00000038886
Gene Namemannosidase 2, alpha 2
Synonymsalpha mannosidase IIx, 1700052O22Rik, MX, 4931438M07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R8376 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location80349097-80371375 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 80360923 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 773 (W773*)
Ref Sequence ENSEMBL: ENSMUSP00000095949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098346] [ENSMUST00000206301] [ENSMUST00000206807]
Predicted Effect probably null
Transcript: ENSMUST00000098346
AA Change: W773*
SMART Domains Protein: ENSMUSP00000095949
Gene: ENSMUSG00000038886
AA Change: W773*

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
coiled coil region 44 75 N/A INTRINSIC
Pfam:Glyco_hydro_38 167 497 1.9e-109 PFAM
Alpha-mann_mid 502 588 1.4e-32 SMART
Pfam:Glyco_hydro_38C 648 1148 1.1e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205853
Predicted Effect probably benign
Transcript: ENSMUST00000206301
Predicted Effect probably benign
Transcript: ENSMUST00000206807
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null males are infertile due to a defect during spermatogenesis involving the premature release of germ cells from the seminiferous tubules into the epididymis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
Adam32 A C 8: 24,919,920 I173S possibly damaging Het
Ahctf1 T C 1: 179,782,955 D599G probably damaging Het
Alkal2 G T 12: 30,884,851 G23V probably damaging Het
Ankrd40 G T 11: 94,334,836 G231V probably damaging Het
Apba2 T A 7: 64,695,593 V177D probably benign Het
Atp12a G T 14: 56,374,626 probably null Het
Birc6 C T 17: 74,589,640 T1027M probably benign Het
Bmpr2 G A 1: 59,867,356 R536H probably damaging Het
Brms1l C A 12: 55,841,629 N67K probably benign Het
Cachd1 G A 4: 100,974,876 R745H probably damaging Het
Cacnb4 G A 2: 52,464,653 Q238* probably null Het
Cdc42 G A 4: 137,328,894 T102I probably benign Het
Cfhr1 A C 1: 139,547,811 C307W unknown Het
Ddb1 G A 19: 10,619,305 V463M probably damaging Het
Dhx30 G A 9: 110,088,639 R365C probably benign Het
Dnah1 A G 14: 31,301,346 F1005L probably damaging Het
Elp4 A G 2: 105,842,308 V144A probably benign Het
Enpp2 T A 15: 54,910,095 N77Y probably damaging Het
Fsip1 C T 2: 118,233,038 V317I possibly damaging Het
Gc G A 5: 89,438,259 Q341* probably null Het
Gpt2 A T 8: 85,493,065 I47F probably benign Het
Ino80 A T 2: 119,442,487 S503T probably benign Het
Kcnn4 C A 7: 24,377,626 T200K possibly damaging Het
Krtap4-7 A G 11: 99,643,927 S37P unknown Het
Lrrc4b T C 7: 44,462,594 V630A probably benign Het
Mgrn1 T A 16: 4,915,766 L192Q probably damaging Het
Mtx1 A G 3: 89,214,171 V52A probably benign Het
Myc A T 15: 61,987,546 N24Y possibly damaging Het
Nbea G A 3: 55,643,655 S2696L possibly damaging Het
Nox4 A G 7: 87,374,384 N493D probably damaging Het
Olfr692 C A 7: 105,368,640 P105T probably benign Het
Osbpl10 G A 9: 115,223,593 G403D probably damaging Het
Pdcd6ip A T 9: 113,689,616 L192Q probably damaging Het
Pde3a A G 6: 141,481,221 I703V possibly damaging Het
Pkd1l3 CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA 8: 109,623,788 probably benign Het
Plcb3 A G 19: 6,966,703 S36P probably damaging Het
Plk5 T C 10: 80,360,345 F279L probably damaging Het
Prl7a1 T G 13: 27,637,655 E99D probably benign Het
Rnf4 C T 5: 34,351,357 R188W probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGAGGCGGCGG 7: 97,579,917 probably benign Het
Scel A G 14: 103,572,015 S264G probably benign Het
Sdk1 A G 5: 142,158,621 Q1712R possibly damaging Het
Slc15a1 A G 14: 121,480,703 Y255H probably benign Het
Syne1 C T 10: 5,043,615 G525D probably benign Het
Taldo1 T C 7: 141,401,875 V214A probably damaging Het
Tbc1d12 A G 19: 38,901,409 T428A probably damaging Het
Tlr6 T C 5: 64,955,112 K151E probably benign Het
Ubr2 T A 17: 46,942,795 D1468V probably benign Het
Ubtf A C 11: 102,308,911 Y463D probably damaging Het
Uroc1 A T 6: 90,337,715 M106L probably damaging Het
Vmn1r55 T A 7: 5,146,870 I185L probably benign Het
Vmn2r93 T A 17: 18,304,968 V296D probably damaging Het
Zfp65 A C 13: 67,708,918 Y81D probably damaging Het
Zw10 A T 9: 49,077,483 Y683F possibly damaging Het
Other mutations in Man2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Man2a2 APN 7 80361132 missense possibly damaging 0.94
IGL01405:Man2a2 APN 7 80360934 missense probably benign 0.00
IGL01717:Man2a2 APN 7 80367365 missense probably damaging 1.00
IGL01843:Man2a2 APN 7 80362906 missense probably benign
IGL02212:Man2a2 APN 7 80362308 missense probably benign 0.00
IGL02383:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02434:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02493:Man2a2 APN 7 80369615 missense possibly damaging 0.68
IGL02528:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02529:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02530:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02534:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02869:Man2a2 APN 7 80363941 missense probably benign 0.00
IGL03084:Man2a2 APN 7 80352943 missense possibly damaging 0.88
IGL03088:Man2a2 APN 7 80359334 missense possibly damaging 0.91
IGL03377:Man2a2 APN 7 80359052 splice site probably null
IGL03412:Man2a2 APN 7 80366998 missense probably damaging 1.00
dugong UTSW 7 80360921 missense probably benign 0.12
R0112:Man2a2 UTSW 7 80358276 missense probably damaging 0.99
R0119:Man2a2 UTSW 7 80367405 missense probably damaging 1.00
R0646:Man2a2 UTSW 7 80363197 missense possibly damaging 0.53
R1184:Man2a2 UTSW 7 80362965 missense possibly damaging 0.79
R1445:Man2a2 UTSW 7 80368562 missense probably benign 0.06
R1626:Man2a2 UTSW 7 80367702 missense probably damaging 1.00
R1739:Man2a2 UTSW 7 80362438 missense probably benign 0.10
R1820:Man2a2 UTSW 7 80358933 missense probably benign 0.22
R2090:Man2a2 UTSW 7 80364110 unclassified probably benign
R2144:Man2a2 UTSW 7 80363516 missense probably damaging 1.00
R2150:Man2a2 UTSW 7 80367784 missense probably damaging 1.00
R3882:Man2a2 UTSW 7 80362315 missense possibly damaging 0.70
R4181:Man2a2 UTSW 7 80351739 missense possibly damaging 0.79
R4285:Man2a2 UTSW 7 80368619 missense probably damaging 1.00
R4302:Man2a2 UTSW 7 80351739 missense possibly damaging 0.79
R4440:Man2a2 UTSW 7 80351715 missense probably benign 0.37
R4494:Man2a2 UTSW 7 80359275 splice site probably null
R4564:Man2a2 UTSW 7 80368838 missense probably benign 0.00
R4631:Man2a2 UTSW 7 80362463 missense probably benign 0.10
R5328:Man2a2 UTSW 7 80368756 missense probably benign 0.06
R5329:Man2a2 UTSW 7 80361128 missense possibly damaging 0.82
R5468:Man2a2 UTSW 7 80352981 missense probably damaging 0.98
R5774:Man2a2 UTSW 7 80368358 missense probably damaging 1.00
R5824:Man2a2 UTSW 7 80353032 missense probably benign 0.00
R5915:Man2a2 UTSW 7 80360921 missense probably benign 0.12
R5937:Man2a2 UTSW 7 80363503 missense probably damaging 1.00
R6101:Man2a2 UTSW 7 80367001 missense probably damaging 1.00
R6105:Man2a2 UTSW 7 80367001 missense probably damaging 1.00
R6481:Man2a2 UTSW 7 80364071 missense probably damaging 0.99
R6592:Man2a2 UTSW 7 80353199 missense probably damaging 0.98
R6869:Man2a2 UTSW 7 80362945 missense probably benign 0.35
R6918:Man2a2 UTSW 7 80353192 missense possibly damaging 0.91
R7137:Man2a2 UTSW 7 80359751 missense probably benign 0.19
R7236:Man2a2 UTSW 7 80368905 missense probably damaging 1.00
R7496:Man2a2 UTSW 7 80352997 missense probably damaging 1.00
R7522:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7523:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7524:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7583:Man2a2 UTSW 7 80366944 missense probably damaging 1.00
R7681:Man2a2 UTSW 7 80351749 missense possibly damaging 0.49
R7828:Man2a2 UTSW 7 80366926 missense probably damaging 0.98
R7843:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7845:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7847:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7848:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7984:Man2a2 UTSW 7 80353308 missense probably damaging 0.99
R8194:Man2a2 UTSW 7 80361018 missense probably benign
R8296:Man2a2 UTSW 7 80368908 missense probably damaging 0.99
R8515:Man2a2 UTSW 7 80368290 missense possibly damaging 0.88
X0057:Man2a2 UTSW 7 80362324 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTTGGCAACTGCTAATGTTC -3'
(R):5'- CCATGCTCACAGGTGTCAGTAC -3'

Sequencing Primer
(F):5'- ATGTTCACACCCAAATCTCTGTGAG -3'
(R):5'- TCACAGGTGTCAGTACCCGTC -3'
Posted On2020-09-02