Incidental Mutation 'R8376:Zw10'
ID646688
Institutional Source Beutler Lab
Gene Symbol Zw10
Ensembl Gene ENSMUSG00000032264
Gene Namezw10 kinetochore protein
SynonymsMmZw10, 6330566F14Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R8376 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location49055613-49078775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49077483 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 683 (Y683F)
Ref Sequence ENSEMBL: ENSMUSP00000034803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034803] [ENSMUST00000165088]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034803
AA Change: Y683F

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034803
Gene: ENSMUSG00000032264
AA Change: Y683F

DomainStartEndE-ValueType
Pfam:Zw10 9 621 2.1e-249 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165088
SMART Domains Protein: ENSMUSP00000132181
Gene: ENSMUSG00000032268

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:SRCR_2 116 213 2.9e-38 PFAM
Tryp_SPc 217 448 1.28e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213787
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is one of many involved in mechanisms to ensure proper chromosome segregation during cell division. This protein is an essential component of the mitotic checkpoint, which prevents cells from prematurely exiting mitosis. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
Adam32 A C 8: 24,919,920 I173S possibly damaging Het
Ahctf1 T C 1: 179,782,955 D599G probably damaging Het
Alkal2 G T 12: 30,884,851 G23V probably damaging Het
Ankrd40 G T 11: 94,334,836 G231V probably damaging Het
Apba2 T A 7: 64,695,593 V177D probably benign Het
Atp12a G T 14: 56,374,626 probably null Het
Birc6 C T 17: 74,589,640 T1027M probably benign Het
Bmpr2 G A 1: 59,867,356 R536H probably damaging Het
Brms1l C A 12: 55,841,629 N67K probably benign Het
Cachd1 G A 4: 100,974,876 R745H probably damaging Het
Cacnb4 G A 2: 52,464,653 Q238* probably null Het
Cdc42 G A 4: 137,328,894 T102I probably benign Het
Cfhr1 A C 1: 139,547,811 C307W unknown Het
Ddb1 G A 19: 10,619,305 V463M probably damaging Het
Dhx30 G A 9: 110,088,639 R365C probably benign Het
Dnah1 A G 14: 31,301,346 F1005L probably damaging Het
Elp4 A G 2: 105,842,308 V144A probably benign Het
Enpp2 T A 15: 54,910,095 N77Y probably damaging Het
Fsip1 C T 2: 118,233,038 V317I possibly damaging Het
Gc G A 5: 89,438,259 Q341* probably null Het
Gpt2 A T 8: 85,493,065 I47F probably benign Het
Ino80 A T 2: 119,442,487 S503T probably benign Het
Kcnn4 C A 7: 24,377,626 T200K possibly damaging Het
Krtap4-7 A G 11: 99,643,927 S37P unknown Het
Lrrc4b T C 7: 44,462,594 V630A probably benign Het
Man2a2 C T 7: 80,360,923 W773* probably null Het
Mgrn1 T A 16: 4,915,766 L192Q probably damaging Het
Mtx1 A G 3: 89,214,171 V52A probably benign Het
Myc A T 15: 61,987,546 N24Y possibly damaging Het
Nbea G A 3: 55,643,655 S2696L possibly damaging Het
Nox4 A G 7: 87,374,384 N493D probably damaging Het
Olfr692 C A 7: 105,368,640 P105T probably benign Het
Osbpl10 G A 9: 115,223,593 G403D probably damaging Het
Pdcd6ip A T 9: 113,689,616 L192Q probably damaging Het
Pde3a A G 6: 141,481,221 I703V possibly damaging Het
Pkd1l3 CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA 8: 109,623,788 probably benign Het
Plcb3 A G 19: 6,966,703 S36P probably damaging Het
Plk5 T C 10: 80,360,345 F279L probably damaging Het
Prl7a1 T G 13: 27,637,655 E99D probably benign Het
Rnf4 C T 5: 34,351,357 R188W probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGAGGCGGCGG 7: 97,579,917 probably benign Het
Scel A G 14: 103,572,015 S264G probably benign Het
Sdk1 A G 5: 142,158,621 Q1712R possibly damaging Het
Slc15a1 A G 14: 121,480,703 Y255H probably benign Het
Syne1 C T 10: 5,043,615 G525D probably benign Het
Taldo1 T C 7: 141,401,875 V214A probably damaging Het
Tbc1d12 A G 19: 38,901,409 T428A probably damaging Het
Tlr6 T C 5: 64,955,112 K151E probably benign Het
Ubr2 T A 17: 46,942,795 D1468V probably benign Het
Ubtf A C 11: 102,308,911 Y463D probably damaging Het
Uroc1 A T 6: 90,337,715 M106L probably damaging Het
Vmn1r55 T A 7: 5,146,870 I185L probably benign Het
Vmn2r93 T A 17: 18,304,968 V296D probably damaging Het
Zfp65 A C 13: 67,708,918 Y81D probably damaging Het
Other mutations in Zw10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Zw10 APN 9 49069615 missense probably benign
IGL02111:Zw10 APN 9 49068754 missense probably damaging 0.98
IGL02673:Zw10 APN 9 49077593 splice site probably null
PIT4382001:Zw10 UTSW 9 49071644 missense probably benign 0.15
R0402:Zw10 UTSW 9 49068723 missense probably benign 0.00
R0736:Zw10 UTSW 9 49064132 missense probably benign 0.00
R1830:Zw10 UTSW 9 49069741 missense probably damaging 1.00
R1966:Zw10 UTSW 9 49068833 missense probably damaging 1.00
R2231:Zw10 UTSW 9 49064121 missense possibly damaging 0.79
R2474:Zw10 UTSW 9 49066805 missense probably damaging 1.00
R2849:Zw10 UTSW 9 49057641 critical splice acceptor site probably null
R3162:Zw10 UTSW 9 49077560 missense probably damaging 0.98
R3162:Zw10 UTSW 9 49077560 missense probably damaging 0.98
R4893:Zw10 UTSW 9 49074025 missense possibly damaging 0.58
R4927:Zw10 UTSW 9 49068683 missense probably damaging 1.00
R5070:Zw10 UTSW 9 49077459 nonsense probably null
R5214:Zw10 UTSW 9 49064163 missense possibly damaging 0.91
R5637:Zw10 UTSW 9 49057650 missense probably damaging 1.00
R5983:Zw10 UTSW 9 49077445 splice site probably null
R6368:Zw10 UTSW 9 49073235 missense probably damaging 1.00
R6605:Zw10 UTSW 9 49069626 missense probably benign 0.00
R7221:Zw10 UTSW 9 49069712 missense probably benign 0.00
R7292:Zw10 UTSW 9 49061191 missense probably benign 0.00
R7938:Zw10 UTSW 9 49071633 missense probably benign 0.04
R8120:Zw10 UTSW 9 49074113 missense probably benign 0.26
RF007:Zw10 UTSW 9 49060920 missense possibly damaging 0.81
Z1177:Zw10 UTSW 9 49074096 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- ACACAAGCTCCTGTGCAGAG -3'
(R):5'- ACGCACCGATCTCCAATTTC -3'

Sequencing Primer
(F):5'- GCTTATATCATTCTAGAGTCAGGAGG -3'
(R):5'- GATCTCCAATTTCTTGCAAGCTAG -3'
Posted On2020-09-02