Incidental Mutation 'R0040:Idh2'
ID64669
Institutional Source Beutler Lab
Gene Symbol Idh2
Ensembl Gene ENSMUSG00000030541
Gene Nameisocitrate dehydrogenase 2 (NADP+), mitochondrial
SynonymsIdh-2, IDPm
MMRRC Submission 038334-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0040 (G1)
Quality Score100
Status Validated
Chromosome7
Chromosomal Location80094846-80115392 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80097822 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 317 (S317P)
Ref Sequence ENSEMBL: ENSMUSP00000103007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107384] [ENSMUST00000125542] [ENSMUST00000134328] [ENSMUST00000164056] [ENSMUST00000206714]
Predicted Effect probably damaging
Transcript: ENSMUST00000107384
AA Change: S317P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103007
Gene: ENSMUSG00000030541
AA Change: S317P

DomainStartEndE-ValueType
Iso_dh 49 441 5.32e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125542
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134070
Predicted Effect probably benign
Transcript: ENSMUST00000134328
SMART Domains Protein: ENSMUSP00000118184
Gene: ENSMUSG00000030541

DomainStartEndE-ValueType
Iso_dh 49 284 1.59e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156761
Predicted Effect probably benign
Transcript: ENSMUST00000164056
SMART Domains Protein: ENSMUSP00000132361
Gene: ENSMUSG00000048897

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
low complexity region 76 88 N/A INTRINSIC
low complexity region 106 127 N/A INTRINSIC
low complexity region 169 181 N/A INTRINSIC
low complexity region 187 201 N/A INTRINSIC
ZnF_C2H2 297 319 2.71e-2 SMART
ZnF_C2H2 325 347 1.92e-2 SMART
ZnF_C2H2 353 375 2.71e-2 SMART
ZnF_C2H2 381 403 1.18e-2 SMART
ZnF_C2H2 409 431 1.67e-2 SMART
ZnF_C2H2 437 459 4.87e-4 SMART
ZnF_C2H2 465 487 3.83e-2 SMART
ZnF_C2H2 493 515 2.12e-4 SMART
ZnF_C2H2 521 543 3.63e-3 SMART
ZnF_C2H2 549 571 1.58e-3 SMART
ZnF_C2H2 577 600 3.69e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206714
Meta Mutation Damage Score 0.9749 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.6%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. Each NADP(+)-dependent isozyme is a homodimer. The protein encoded by this gene is the NADP(+)-dependent isocitrate dehydrogenase found in the mitochondria. It plays a role in intermediary metabolism and energy production. This protein may tightly associate or interact with the pyruvate dehydrogenase complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit suppression of tumorigenesis from B16F10 melanoma cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahrr G A 13: 74,283,024 probably benign Het
Antxr2 G A 5: 97,938,425 T441I possibly damaging Het
Apcs A G 1: 172,894,456 Y108H probably benign Het
Atad5 A G 11: 80,098,014 T666A probably benign Het
Atcay C T 10: 81,210,519 probably null Het
Bahcc1 A G 11: 120,268,370 D141G probably damaging Het
Ceacam10 A G 7: 24,778,264 Y68C probably damaging Het
Cfap54 T A 10: 92,977,039 Q1344L probably benign Het
Cyb5r4 A G 9: 87,066,742 probably null Het
Cyp2b9 G T 7: 26,173,474 S14I possibly damaging Het
Dusp12 A G 1: 170,880,657 Y164H probably damaging Het
Eml2 T C 7: 19,196,614 V373A possibly damaging Het
Fat1 A G 8: 45,026,404 D2829G probably damaging Het
Fbxl13 T C 5: 21,486,373 T671A probably damaging Het
Fbxo28 G T 1: 182,326,240 probably benign Het
Fbxo44 A G 4: 148,158,695 L89P probably damaging Het
Fndc3b T A 3: 27,556,117 probably null Het
Gm884 G A 11: 103,542,990 P942S probably damaging Het
Gm9955 G T 18: 24,709,152 probably benign Het
Gprc6a T A 10: 51,614,984 K819* probably null Het
Gxylt1 A T 15: 93,254,555 probably benign Het
Hspa12a T C 19: 58,799,624 T589A probably benign Het
Ifi30 T C 8: 70,763,776 probably null Het
Ifna16 G A 4: 88,676,630 A76V probably benign Het
Itpr2 C T 6: 146,345,140 E1127K probably damaging Het
Kank4 A G 4: 98,779,220 V330A probably benign Het
Kpna1 T A 16: 36,023,241 D328E probably damaging Het
Krt71 T A 15: 101,738,433 H280L possibly damaging Het
Mapt A G 11: 104,305,398 M446V probably damaging Het
Med1 C T 11: 98,166,255 probably null Het
Mif T A 10: 75,859,780 H63L probably damaging Het
Mycbp2 A G 14: 103,224,272 V1447A probably benign Het
Myo1b A T 1: 51,781,989 I451N probably damaging Het
Nme2 A T 11: 93,951,930 probably null Het
Nubp1 A G 16: 10,421,117 T199A probably damaging Het
Nup210l T A 3: 90,181,905 V1165D probably damaging Het
Nup98 T A 7: 102,192,034 T122S probably damaging Het
Olfr1106 C T 2: 87,049,204 E11K probably damaging Het
Olfr304 A T 7: 86,386,507 L51Q probably benign Het
Olfr354 T C 2: 36,907,458 F171L probably damaging Het
Olfr771 T A 10: 129,160,739 I82L probably benign Het
Pard3b A T 1: 62,637,820 Y1170F probably damaging Het
Pear1 T C 3: 87,754,358 D536G probably damaging Het
Phrf1 G T 7: 141,243,857 R196L probably damaging Het
Plxna2 G T 1: 194,643,896 R46L probably benign Het
Rbm39 G A 2: 156,148,179 T496I possibly damaging Het
Rpl14 C G 9: 120,572,101 F3L possibly damaging Het
Rtf2 G A 2: 172,444,696 S40N probably damaging Het
Runx2 G A 17: 44,608,254 S481L possibly damaging Het
Sh3rf1 T A 8: 61,329,252 Y143N possibly damaging Het
Siglec15 G A 18: 78,048,877 probably benign Het
Slc4a8 T A 15: 100,789,846 I288N probably damaging Het
Ttc38 C A 15: 85,841,489 F184L probably damaging Het
Vmn1r28 T C 6: 58,265,894 Y241H probably damaging Het
Vmn2r110 A T 17: 20,596,084 V59D probably benign Het
Wdpcp A G 11: 21,711,638 I303M probably damaging Het
Zc3h12d G A 10: 7,867,914 A483T probably benign Het
Zfp106 C A 2: 120,531,613 K1008N probably damaging Het
Zfp334 A G 2: 165,381,572 Y184H probably benign Het
Zfp68 G A 5: 138,607,779 T94I probably benign Het
Zkscan3 A T 13: 21,394,920 probably null Het
Other mutations in Idh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Idh2 APN 7 80097945 missense probably benign
IGL02281:Idh2 APN 7 80095802 unclassified probably null
IGL02874:Idh2 APN 7 80097873 missense probably damaging 1.00
IGL02892:Idh2 APN 7 80095670 missense probably benign
IGL02937:Idh2 APN 7 80098913 missense probably damaging 1.00
IGL02989:Idh2 APN 7 80099108 missense probably damaging 1.00
R0040:Idh2 UTSW 7 80097822 missense probably damaging 1.00
R0090:Idh2 UTSW 7 80097914 missense probably damaging 1.00
R0322:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R0384:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R0385:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R0386:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R0387:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R0494:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R1603:Idh2 UTSW 7 80099158 missense probably damaging 1.00
R1681:Idh2 UTSW 7 80099158 missense probably damaging 1.00
R1711:Idh2 UTSW 7 80099158 missense probably damaging 1.00
R1844:Idh2 UTSW 7 80098877 missense probably benign 0.31
R3700:Idh2 UTSW 7 80099147 missense probably damaging 1.00
R4941:Idh2 UTSW 7 80096099 missense probably damaging 0.98
R5234:Idh2 UTSW 7 80096105 missense probably damaging 0.99
R5387:Idh2 UTSW 7 80098331 intron probably benign
R5582:Idh2 UTSW 7 80098339 frame shift probably null
R5655:Idh2 UTSW 7 80098248 missense probably damaging 0.99
R6191:Idh2 UTSW 7 80098331 intron probably benign
R6261:Idh2 UTSW 7 80098329 intron probably benign
R6311:Idh2 UTSW 7 80098331 intron probably benign
R6351:Idh2 UTSW 7 80098331 intron probably benign
R6413:Idh2 UTSW 7 80098331 intron probably benign
R6561:Idh2 UTSW 7 80098331 intron probably benign
R6709:Idh2 UTSW 7 80098331 intron probably benign
R6772:Idh2 UTSW 7 80098331 intron probably benign
R6781:Idh2 UTSW 7 80098331 intron probably benign
R6848:Idh2 UTSW 7 80098331 intron probably benign
R6861:Idh2 UTSW 7 80098218 missense probably damaging 1.00
R6899:Idh2 UTSW 7 80098331 intron probably benign
R7063:Idh2 UTSW 7 80095684 missense probably damaging 1.00
R7076:Idh2 UTSW 7 80098331 intron probably benign
R7081:Idh2 UTSW 7 80098329 intron probably benign
R7090:Idh2 UTSW 7 80098331 intron probably benign
R7254:Idh2 UTSW 7 80098331 frame shift probably null
R7298:Idh2 UTSW 7 80098331 intron probably benign
R7401:Idh2 UTSW 7 80098329 intron probably benign
R7560:Idh2 UTSW 7 80098331 frame shift probably null
R7561:Idh2 UTSW 7 80098331 intron probably benign
R7694:Idh2 UTSW 7 80098331 intron probably benign
R7816:Idh2 UTSW 7 80098331 intron probably benign
R7884:Idh2 UTSW 7 80098329 intron probably benign
R7936:Idh2 UTSW 7 80098331 intron probably benign
R7940:Idh2 UTSW 7 80098331 intron probably benign
R7942:Idh2 UTSW 7 80098331 intron probably benign
R7980:Idh2 UTSW 7 80098329 intron probably benign
R8009:Idh2 UTSW 7 80098253 missense probably benign 0.18
R8036:Idh2 UTSW 7 80098331 intron probably benign
RF030:Idh2 UTSW 7 80098329 intron probably benign
Predicted Primers PCR Primer
(F):5'- TCACGTAACCCTTGTGCTTACACAATC -3'
(R):5'- TGACAAGTAACAACCTCTGATGCTTCC -3'

Sequencing Primer
(F):5'- tcaggaggcagaggcag -3'
(R):5'- GGGGTCTTTAACCTGCCAAC -3'
Posted On2013-08-06