Incidental Mutation 'R8376:Pdcd6ip'
ID646690
Institutional Source Beutler Lab
Gene Symbol Pdcd6ip
Ensembl Gene ENSMUSG00000032504
Gene Nameprogrammed cell death 6 interacting protein
SynonymsAlix, AIP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8376 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location113651744-113708259 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 113689616 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 192 (L192Q)
Ref Sequence ENSEMBL: ENSMUSP00000107492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035086] [ENSMUST00000111861]
Predicted Effect probably damaging
Transcript: ENSMUST00000035086
AA Change: L192Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035086
Gene: ENSMUSG00000032504
AA Change: L192Q

DomainStartEndE-ValueType
BRO1 3 382 1.99e-160 SMART
Pfam:ALIX_LYPXL_bnd 408 702 3.6e-91 PFAM
low complexity region 731 812 N/A INTRINSIC
Blast:BRO1 813 839 2e-11 BLAST
low complexity region 840 869 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111861
AA Change: L192Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107492
Gene: ENSMUSG00000032504
AA Change: L192Q

DomainStartEndE-ValueType
BRO1 3 387 3.46e-160 SMART
Pfam:ALIX_LYPXL_bnd 417 706 8.8e-96 PFAM
low complexity region 736 817 N/A INTRINSIC
Blast:BRO1 818 844 2e-11 BLAST
low complexity region 845 874 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions within the ESCRT pathway in the abscission stage of cytokinesis, in intralumenal endosomal vesicle formation, and in enveloped virus budding. Studies using mouse cells have shown that overexpression of this protein can block apoptosis. In addition, the product of this gene binds to the product of the PDCD6 gene, a protein required for apoptosis, in a calcium-dependent manner. This gene product also binds to endophilins, proteins that regulate membrane shape during endocytosis. Overexpression of this gene product and endophilins results in cytoplasmic vacuolization, which may be partly responsible for the protection against cell death. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. Related pseudogenes have been identified on chromosome 15. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele show decreased body and brain size and exhibit structural defects in the epithelium of the choroid plexus and in the brain ependyma that culminate in excessive cell extrusion, enlargement of the lateral ventricles, and hydrocephalus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
Adam32 A C 8: 24,919,920 I173S possibly damaging Het
Ahctf1 T C 1: 179,782,955 D599G probably damaging Het
Alkal2 G T 12: 30,884,851 G23V probably damaging Het
Ankrd40 G T 11: 94,334,836 G231V probably damaging Het
Apba2 T A 7: 64,695,593 V177D probably benign Het
Atp12a G T 14: 56,374,626 probably null Het
Birc6 C T 17: 74,589,640 T1027M probably benign Het
Bmpr2 G A 1: 59,867,356 R536H probably damaging Het
Brms1l C A 12: 55,841,629 N67K probably benign Het
Cachd1 G A 4: 100,974,876 R745H probably damaging Het
Cacnb4 G A 2: 52,464,653 Q238* probably null Het
Cdc42 G A 4: 137,328,894 T102I probably benign Het
Cfhr1 A C 1: 139,547,811 C307W unknown Het
Ddb1 G A 19: 10,619,305 V463M probably damaging Het
Dhx30 G A 9: 110,088,639 R365C probably benign Het
Dnah1 A G 14: 31,301,346 F1005L probably damaging Het
Elp4 A G 2: 105,842,308 V144A probably benign Het
Enpp2 T A 15: 54,910,095 N77Y probably damaging Het
Fsip1 C T 2: 118,233,038 V317I possibly damaging Het
Gc G A 5: 89,438,259 Q341* probably null Het
Gpt2 A T 8: 85,493,065 I47F probably benign Het
Ino80 A T 2: 119,442,487 S503T probably benign Het
Kcnn4 C A 7: 24,377,626 T200K possibly damaging Het
Krtap4-7 A G 11: 99,643,927 S37P unknown Het
Lrrc4b T C 7: 44,462,594 V630A probably benign Het
Man2a2 C T 7: 80,360,923 W773* probably null Het
Mgrn1 T A 16: 4,915,766 L192Q probably damaging Het
Mtx1 A G 3: 89,214,171 V52A probably benign Het
Myc A T 15: 61,987,546 N24Y possibly damaging Het
Nbea G A 3: 55,643,655 S2696L possibly damaging Het
Nox4 A G 7: 87,374,384 N493D probably damaging Het
Olfr692 C A 7: 105,368,640 P105T probably benign Het
Osbpl10 G A 9: 115,223,593 G403D probably damaging Het
Pde3a A G 6: 141,481,221 I703V possibly damaging Het
Pkd1l3 CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA 8: 109,623,788 probably benign Het
Plcb3 A G 19: 6,966,703 S36P probably damaging Het
Plk5 T C 10: 80,360,345 F279L probably damaging Het
Prl7a1 T G 13: 27,637,655 E99D probably benign Het
Rnf4 C T 5: 34,351,357 R188W probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGAGGCGGCGG 7: 97,579,917 probably benign Het
Scel A G 14: 103,572,015 S264G probably benign Het
Sdk1 A G 5: 142,158,621 Q1712R possibly damaging Het
Slc15a1 A G 14: 121,480,703 Y255H probably benign Het
Syne1 C T 10: 5,043,615 G525D probably benign Het
Taldo1 T C 7: 141,401,875 V214A probably damaging Het
Tbc1d12 A G 19: 38,901,409 T428A probably damaging Het
Tlr6 T C 5: 64,955,112 K151E probably benign Het
Ubr2 T A 17: 46,942,795 D1468V probably benign Het
Ubtf A C 11: 102,308,911 Y463D probably damaging Het
Uroc1 A T 6: 90,337,715 M106L probably damaging Het
Vmn1r55 T A 7: 5,146,870 I185L probably benign Het
Vmn2r93 T A 17: 18,304,968 V296D probably damaging Het
Zfp65 A C 13: 67,708,918 Y81D probably damaging Het
Zw10 A T 9: 49,077,483 Y683F possibly damaging Het
Other mutations in Pdcd6ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Pdcd6ip APN 9 113697518 missense possibly damaging 0.89
IGL00814:Pdcd6ip APN 9 113687653 missense probably damaging 0.97
IGL01092:Pdcd6ip APN 9 113680181 splice site probably benign
IGL01621:Pdcd6ip APN 9 113685422 missense probably benign 0.03
IGL01781:Pdcd6ip APN 9 113691498 missense probably damaging 1.00
IGL02158:Pdcd6ip APN 9 113680053 nonsense probably null
IGL03136:Pdcd6ip APN 9 113691499 missense probably damaging 1.00
IGL03137:Pdcd6ip APN 9 113657145 missense possibly damaging 0.69
IGL03246:Pdcd6ip APN 9 113678417 missense possibly damaging 0.93
R0230:Pdcd6ip UTSW 9 113685293 splice site probably benign
R0284:Pdcd6ip UTSW 9 113662504 missense probably damaging 1.00
R0862:Pdcd6ip UTSW 9 113674510 splice site probably benign
R0864:Pdcd6ip UTSW 9 113674510 splice site probably benign
R1025:Pdcd6ip UTSW 9 113662286 missense probably damaging 1.00
R1687:Pdcd6ip UTSW 9 113700019 missense probably damaging 1.00
R1699:Pdcd6ip UTSW 9 113678354 missense probably damaging 1.00
R1957:Pdcd6ip UTSW 9 113708022 missense probably damaging 1.00
R2317:Pdcd6ip UTSW 9 113672774 missense probably benign 0.03
R2698:Pdcd6ip UTSW 9 113674507 splice site probably null
R4182:Pdcd6ip UTSW 9 113700010 missense probably benign 0.00
R5154:Pdcd6ip UTSW 9 113691542 missense probably damaging 1.00
R5229:Pdcd6ip UTSW 9 113678333 missense probably damaging 0.99
R5391:Pdcd6ip UTSW 9 113691518 missense probably damaging 1.00
R5972:Pdcd6ip UTSW 9 113662298 missense probably benign 0.07
R6149:Pdcd6ip UTSW 9 113659871 missense probably benign 0.03
R6406:Pdcd6ip UTSW 9 113674344 missense possibly damaging 0.81
R6514:Pdcd6ip UTSW 9 113689694 missense probably benign 0.43
R6869:Pdcd6ip UTSW 9 113655106 missense unknown
R6888:Pdcd6ip UTSW 9 113671837 missense probably benign 0.04
R7078:Pdcd6ip UTSW 9 113659885 missense probably benign 0.01
R7683:Pdcd6ip UTSW 9 113687695 missense probably damaging 1.00
R8260:Pdcd6ip UTSW 9 113672797 missense probably benign 0.05
Z1177:Pdcd6ip UTSW 9 113685369 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACTGCCACAGGAAGCTTTC -3'
(R):5'- ACCATCTTTTCAGTTGGCATG -3'

Sequencing Primer
(F):5'- GCGTAACTCTCCTTCTGAAGTGAG -3'
(R):5'- CCATCTTTTCAGTTGGCATGTAGAAG -3'
Posted On2020-09-02