Mutagenetix > Incidental Mutations

Incidental Mutation 'R8376:Slc15a1'

646704

Institutional Source

Beutler Lab

Gene Symbol

Slc15a1

Ensembl Gene

ENSMUSG00000025557

Gene Name

solute carrier family 15 (oligopeptide transporter), member 1

Synonyms

PECT1, PEPT1

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.058) question?

Stock #

R8376 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

121459621-121505252 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 121480703 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 255 (Y255H)

Ref Sequence

ENSEMBL: ENSMUSP00000085728 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088386]

Predicted Effect

probably benign
Transcript: ENSMUST00000088386
AA Change: Y255H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000085728
Gene: ENSMUSG00000025557
AA Change: Y255H

Domain	Start	End	E-Value	Type
Pfam:PTR2	81	477	1.9e-141	PFAM
Pfam:PTR2	562	644	4.2e-11	PFAM
transmembrane domain	650	672	N/A	INTRINSIC
low complexity region	684	695	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intestinal hydrogen peptide cotransporter that is a member of the solute carrier family 15. The encoded protein is localized to the brush border membrane of the intestinal epithelium and mediates the uptake of di- and tripeptides from the lumen into the enterocytes. This protein plays an important role in the uptake and digestion of dietary proteins. This protein also facilitates the absorption of numerous peptidomimetic drugs. [provided by RefSeq, Apr 2010]
PHENOTYPE: Peptide uptake in the intestine is substantially reduced in mice homozygous for a null mutation of this gene. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	C	A	17: 33,067,064	A255S	probably benign	Het
Adam32	A	C	8: 24,919,920	I173S	possibly damaging	Het
Ahctf1	T	C	1: 179,782,955	D599G	probably damaging	Het
Alkal2	G	T	12: 30,884,851	G23V	probably damaging	Het
Ankrd40	G	T	11: 94,334,836	G231V	probably damaging	Het
Apba2	T	A	7: 64,695,593	V177D	probably benign	Het
Atp12a	G	T	14: 56,374,626		probably null	Het
Birc6	C	T	17: 74,589,640	T1027M	probably benign	Het
Bmpr2	G	A	1: 59,867,356	R536H	probably damaging	Het
Brms1l	C	A	12: 55,841,629	N67K	probably benign	Het
Cachd1	G	A	4: 100,974,876	R745H	probably damaging	Het
Cacnb4	G	A	2: 52,464,653	Q238*	probably null	Het
Cdc42	G	A	4: 137,328,894	T102I	probably benign	Het
Cfhr1	A	C	1: 139,547,811	C307W	unknown	Het
Ddb1	G	A	19: 10,619,305	V463M	probably damaging	Het
Dhx30	G	A	9: 110,088,639	R365C	probably benign	Het
Dnah1	A	G	14: 31,301,346	F1005L	probably damaging	Het
Elp4	A	G	2: 105,842,308	V144A	probably benign	Het
Enpp2	T	A	15: 54,910,095	N77Y	probably damaging	Het
Fsip1	C	T	2: 118,233,038	V317I	possibly damaging	Het
Gc	G	A	5: 89,438,259	Q341*	probably null	Het
Gpt2	A	T	8: 85,493,065	I47F	probably benign	Het
Ino80	A	T	2: 119,442,487	S503T	probably benign	Het
Kcnn4	C	A	7: 24,377,626	T200K	possibly damaging	Het
Krtap4-7	A	G	11: 99,643,927	S37P	unknown	Het
Lrrc4b	T	C	7: 44,462,594	V630A	probably benign	Het
Man2a2	C	T	7: 80,360,923	W773*	probably null	Het
Mgrn1	T	A	16: 4,915,766	L192Q	probably damaging	Het
Mtx1	A	G	3: 89,214,171	V52A	probably benign	Het
Myc	A	T	15: 61,987,546	N24Y	possibly damaging	Het
Nbea	G	A	3: 55,643,655	S2696L	possibly damaging	Het
Nox4	A	G	7: 87,374,384	N493D	probably damaging	Het
Olfr692	C	A	7: 105,368,640	P105T	probably benign	Het
Osbpl10	G	A	9: 115,223,593	G403D	probably damaging	Het
Pdcd6ip	A	T	9: 113,689,616	L192Q	probably damaging	Het
Pde3a	A	G	6: 141,481,221	I703V	possibly damaging	Het
Pkd1l3	CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA	CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA	8: 109,623,788		probably benign	Het
Plcb3	A	G	19: 6,966,703	S36P	probably damaging	Het
Plk5	T	C	10: 80,360,345	F279L	probably damaging	Het
Prl7a1	T	G	13: 27,637,655	E99D	probably benign	Het
Rnf4	C	T	5: 34,351,357	R188W	probably damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGAGGCGGCGG	7: 97,579,917		probably benign	Het
Scel	A	G	14: 103,572,015	S264G	probably benign	Het
Sdk1	A	G	5: 142,158,621	Q1712R	possibly damaging	Het
Syne1	C	T	10: 5,043,615	G525D	probably benign	Het
Taldo1	T	C	7: 141,401,875	V214A	probably damaging	Het
Tbc1d12	A	G	19: 38,901,409	T428A	probably damaging	Het
Tlr6	T	C	5: 64,955,112	K151E	probably benign	Het
Ubr2	T	A	17: 46,942,795	D1468V	probably benign	Het
Ubtf	A	C	11: 102,308,911	Y463D	probably damaging	Het
Uroc1	A	T	6: 90,337,715	M106L	probably damaging	Het
Vmn1r55	T	A	7: 5,146,870	I185L	probably benign	Het
Vmn2r93	T	A	17: 18,304,968	V296D	probably damaging	Het
Zfp65	A	C	13: 67,708,918	Y81D	probably damaging	Het
Zw10	A	T	9: 49,077,483	Y683F	possibly damaging	Het

Other mutations in Slc15a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01337:Slc15a1	APN	14	121460679	missense	possibly damaging	0.95
IGL01534:Slc15a1	APN	14	121464952	missense	possibly damaging	0.95
IGL01783:Slc15a1	APN	14	121471276	critical splice donor site	probably null
IGL01799:Slc15a1	APN	14	121480729	missense	possibly damaging	0.76
IGL02064:Slc15a1	APN	14	121462499	missense	possibly damaging	0.66
IGL02064:Slc15a1	APN	14	121462474	missense	probably benign	0.20
IGL02115:Slc15a1	APN	14	121480661	missense	possibly damaging	0.61
IGL02514:Slc15a1	APN	14	121487040	missense	probably damaging	1.00
IGL03056:Slc15a1	APN	14	121491283	missense	possibly damaging	0.82
IGL03297:Slc15a1	APN	14	121486684	missense	probably damaging	1.00
R1484:Slc15a1	UTSW	14	121491239	nonsense	probably null
R1532:Slc15a1	UTSW	14	121475984	missense	possibly damaging	0.79
R1655:Slc15a1	UTSW	14	121465899	missense	probably benign	0.34
R2013:Slc15a1	UTSW	14	121475987	missense	possibly damaging	0.88
R2270:Slc15a1	UTSW	14	121479994	missense	probably damaging	0.99
R2878:Slc15a1	UTSW	14	121465933	missense	probably benign	0.00
R2986:Slc15a1	UTSW	14	121489809	missense	probably benign	0.02
R3862:Slc15a1	UTSW	14	121484857	missense	probably benign	0.06
R3863:Slc15a1	UTSW	14	121484857	missense	probably benign	0.06
R3978:Slc15a1	UTSW	14	121489827	missense	probably benign	0.00
R4184:Slc15a1	UTSW	14	121466162	missense	probably benign	0.00
R4573:Slc15a1	UTSW	14	121487029	missense	probably damaging	0.99
R4604:Slc15a1	UTSW	14	121489907	missense	probably damaging	1.00
R4649:Slc15a1	UTSW	14	121478092	missense	probably damaging	1.00
R5838:Slc15a1	UTSW	14	121484871	missense	probably damaging	1.00
R6221:Slc15a1	UTSW	14	121464904	missense	probably null	1.00
R6891:Slc15a1	UTSW	14	121476030	missense	probably benign	0.00
R7626:Slc15a1	UTSW	14	121475965	missense	probably benign	0.13
R7836:Slc15a1	UTSW	14	121480733	nonsense	probably null
R8284:Slc15a1	UTSW	14	121489863	missense	probably benign	0.01
R8408:Slc15a1	UTSW	14	121478116	missense	possibly damaging	0.91
Z1088:Slc15a1	UTSW	14	121480054	missense	probably benign	0.09
Z1088:Slc15a1	UTSW	14	121491044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGTTCTCCAGTCCACACAC -3'
(R):5'- CAGACTGGAGGGTAAACTGCTG -3'

Sequencing Primer
(F):5'- GTCCACACACTATTAGCATTGGGAG -3'
(R):5'- ACTGCTGGGAAGGAGACTCC -3'

Posted On

2020-09-02