Incidental Mutation 'R8376:Mgrn1'
ID646707
Institutional Source Beutler Lab
Gene Symbol Mgrn1
Ensembl Gene ENSMUSG00000022517
Gene Namemahogunin, ring finger 1
Synonyms2610042J20Rik, nc
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8376 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location4886249-4938296 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4915766 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 192 (L192Q)
Ref Sequence ENSEMBL: ENSMUSP00000023159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023159] [ENSMUST00000070658] [ENSMUST00000229038] [ENSMUST00000230990]
Predicted Effect probably damaging
Transcript: ENSMUST00000023159
AA Change: L192Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023159
Gene: ENSMUSG00000022517
AA Change: L192Q

DomainStartEndE-ValueType
low complexity region 205 216 N/A INTRINSIC
low complexity region 268 278 N/A INTRINSIC
RING 279 317 4.58e-4 SMART
low complexity region 349 360 N/A INTRINSIC
low complexity region 443 454 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000070658
AA Change: L192Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000068314
Gene: ENSMUSG00000022517
AA Change: L192Q

DomainStartEndE-ValueType
low complexity region 204 215 N/A INTRINSIC
low complexity region 267 277 N/A INTRINSIC
RING 278 316 4.58e-4 SMART
low complexity region 348 359 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000229038
AA Change: L193Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000230990
AA Change: L192Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mahogunin (MGRN1) is a C3HC4 RING-containing protein with E3 ubiquitin ligase activity in vitro.[supplied by OMIM, Apr 2004]
PHENOTYPE: Homozygotes for mutant alleles exhibit darkening of agouti hair and suppression of the obesity associated with certain agouti mutations. Homozygotes for an induced null mutation also have curly whiskers and develop a progressive spongiform neuropathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
Adam32 A C 8: 24,919,920 I173S possibly damaging Het
Ahctf1 T C 1: 179,782,955 D599G probably damaging Het
Alkal2 G T 12: 30,884,851 G23V probably damaging Het
Ankrd40 G T 11: 94,334,836 G231V probably damaging Het
Apba2 T A 7: 64,695,593 V177D probably benign Het
Atp12a G T 14: 56,374,626 probably null Het
Birc6 C T 17: 74,589,640 T1027M probably benign Het
Bmpr2 G A 1: 59,867,356 R536H probably damaging Het
Brms1l C A 12: 55,841,629 N67K probably benign Het
Cachd1 G A 4: 100,974,876 R745H probably damaging Het
Cacnb4 G A 2: 52,464,653 Q238* probably null Het
Cdc42 G A 4: 137,328,894 T102I probably benign Het
Cfhr1 A C 1: 139,547,811 C307W unknown Het
Ddb1 G A 19: 10,619,305 V463M probably damaging Het
Dhx30 G A 9: 110,088,639 R365C probably benign Het
Dnah1 A G 14: 31,301,346 F1005L probably damaging Het
Elp4 A G 2: 105,842,308 V144A probably benign Het
Enpp2 T A 15: 54,910,095 N77Y probably damaging Het
Fsip1 C T 2: 118,233,038 V317I possibly damaging Het
Gc G A 5: 89,438,259 Q341* probably null Het
Gpt2 A T 8: 85,493,065 I47F probably benign Het
Ino80 A T 2: 119,442,487 S503T probably benign Het
Kcnn4 C A 7: 24,377,626 T200K possibly damaging Het
Krtap4-7 A G 11: 99,643,927 S37P unknown Het
Lrrc4b T C 7: 44,462,594 V630A probably benign Het
Man2a2 C T 7: 80,360,923 W773* probably null Het
Mtx1 A G 3: 89,214,171 V52A probably benign Het
Myc A T 15: 61,987,546 N24Y possibly damaging Het
Nbea G A 3: 55,643,655 S2696L possibly damaging Het
Nox4 A G 7: 87,374,384 N493D probably damaging Het
Olfr692 C A 7: 105,368,640 P105T probably benign Het
Osbpl10 G A 9: 115,223,593 G403D probably damaging Het
Pdcd6ip A T 9: 113,689,616 L192Q probably damaging Het
Pde3a A G 6: 141,481,221 I703V possibly damaging Het
Pkd1l3 CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA 8: 109,623,788 probably benign Het
Plcb3 A G 19: 6,966,703 S36P probably damaging Het
Plk5 T C 10: 80,360,345 F279L probably damaging Het
Prl7a1 T G 13: 27,637,655 E99D probably benign Het
Rnf4 C T 5: 34,351,357 R188W probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGAGGCGGCGG 7: 97,579,917 probably benign Het
Scel A G 14: 103,572,015 S264G probably benign Het
Sdk1 A G 5: 142,158,621 Q1712R possibly damaging Het
Slc15a1 A G 14: 121,480,703 Y255H probably benign Het
Syne1 C T 10: 5,043,615 G525D probably benign Het
Taldo1 T C 7: 141,401,875 V214A probably damaging Het
Tbc1d12 A G 19: 38,901,409 T428A probably damaging Het
Tlr6 T C 5: 64,955,112 K151E probably benign Het
Ubr2 T A 17: 46,942,795 D1468V probably benign Het
Ubtf A C 11: 102,308,911 Y463D probably damaging Het
Uroc1 A T 6: 90,337,715 M106L probably damaging Het
Vmn1r55 T A 7: 5,146,870 I185L probably benign Het
Vmn2r93 T A 17: 18,304,968 V296D probably damaging Het
Zfp65 A C 13: 67,708,918 Y81D probably damaging Het
Zw10 A T 9: 49,077,483 Y683F possibly damaging Het
Other mutations in Mgrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Mgrn1 APN 16 4916155 critical splice donor site probably null
IGL02175:Mgrn1 APN 16 4920368 missense probably benign 0.02
IGL02382:Mgrn1 APN 16 4922618 missense probably damaging 0.97
R1204:Mgrn1 UTSW 16 4907409 missense probably damaging 1.00
R1515:Mgrn1 UTSW 16 4915780 missense probably benign 0.11
R1625:Mgrn1 UTSW 16 4910763 missense probably damaging 1.00
R2875:Mgrn1 UTSW 16 4907416 missense possibly damaging 0.85
R4928:Mgrn1 UTSW 16 4927862 missense probably benign 0.29
R4955:Mgrn1 UTSW 16 4934219 missense probably benign 0.00
R6085:Mgrn1 UTSW 16 4920376 missense probably benign 0.01
R6189:Mgrn1 UTSW 16 4910810 critical splice donor site probably null
R7095:Mgrn1 UTSW 16 4927664 splice site probably null
R7293:Mgrn1 UTSW 16 4932220 missense probably benign 0.01
R7610:Mgrn1 UTSW 16 4934233 makesense probably null
R8187:Mgrn1 UTSW 16 4920365 missense probably benign 0.02
Z1177:Mgrn1 UTSW 16 4922724 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TTTCACCCAAAACAGGAGACT -3'
(R):5'- AGACACCCTGTTCCCAGAAGAG -3'

Sequencing Primer
(F):5'- GACTGGATGATAGCACTGTTCAC -3'
(R):5'- AGGAGGTCCTCTGATGACTCAG -3'
Posted On2020-09-02