Incidental Mutation 'R8376:Ubr2'
ID646710
Institutional Source Beutler Lab
Gene Symbol Ubr2
Ensembl Gene ENSMUSG00000023977
Gene Nameubiquitin protein ligase E3 component n-recognin 2
Synonyms9930021A08Rik, E130209G04Rik, ENSMUSG00000043296
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.893) question?
Stock #R8376 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location46928295-47010556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46942795 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1468 (D1468V)
Ref Sequence ENSEMBL: ENSMUSP00000108961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113335] [ENSMUST00000113337]
Predicted Effect probably benign
Transcript: ENSMUST00000113335
AA Change: D1468V

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000108961
Gene: ENSMUSG00000023977
AA Change: D1468V

DomainStartEndE-ValueType
ZnF_UBR1 97 167 3.14e-32 SMART
Pfam:ClpS 221 302 2.4e-23 PFAM
low complexity region 635 646 N/A INTRINSIC
low complexity region 749 760 N/A INTRINSIC
low complexity region 872 886 N/A INTRINSIC
coiled coil region 1019 1046 N/A INTRINSIC
RING 1108 1213 7.66e-1 SMART
low complexity region 1221 1235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113337
AA Change: D1468V

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108963
Gene: ENSMUSG00000023977
AA Change: D1468V

DomainStartEndE-ValueType
ZnF_UBR1 97 167 3.14e-32 SMART
Pfam:ClpS 222 301 6.2e-26 PFAM
low complexity region 635 646 N/A INTRINSIC
low complexity region 749 760 N/A INTRINSIC
low complexity region 872 886 N/A INTRINSIC
coiled coil region 1019 1046 N/A INTRINSIC
RING 1108 1213 7.66e-1 SMART
low complexity region 1221 1235 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin ligase of the N-end rule proteolytic pathway that targets proteins with destabilizing N-terminal residues for polyubiquitylation and proteasome-mediated degradation. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: On a mixed genetic background, female homozygotes for a targeted null mutation exhibit embryonic lethality, while males are viable, but sterile due to postnatal testicular degeneration. On an inbred background, both genders die in utero. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
Adam32 A C 8: 24,919,920 I173S possibly damaging Het
Ahctf1 T C 1: 179,782,955 D599G probably damaging Het
Alkal2 G T 12: 30,884,851 G23V probably damaging Het
Ankrd40 G T 11: 94,334,836 G231V probably damaging Het
Apba2 T A 7: 64,695,593 V177D probably benign Het
Atp12a G T 14: 56,374,626 probably null Het
Birc6 C T 17: 74,589,640 T1027M probably benign Het
Bmpr2 G A 1: 59,867,356 R536H probably damaging Het
Brms1l C A 12: 55,841,629 N67K probably benign Het
Cachd1 G A 4: 100,974,876 R745H probably damaging Het
Cacnb4 G A 2: 52,464,653 Q238* probably null Het
Cdc42 G A 4: 137,328,894 T102I probably benign Het
Cfhr1 A C 1: 139,547,811 C307W unknown Het
Ddb1 G A 19: 10,619,305 V463M probably damaging Het
Dhx30 G A 9: 110,088,639 R365C probably benign Het
Dnah1 A G 14: 31,301,346 F1005L probably damaging Het
Elp4 A G 2: 105,842,308 V144A probably benign Het
Enpp2 T A 15: 54,910,095 N77Y probably damaging Het
Fsip1 C T 2: 118,233,038 V317I possibly damaging Het
Gc G A 5: 89,438,259 Q341* probably null Het
Gpt2 A T 8: 85,493,065 I47F probably benign Het
Ino80 A T 2: 119,442,487 S503T probably benign Het
Kcnn4 C A 7: 24,377,626 T200K possibly damaging Het
Krtap4-7 A G 11: 99,643,927 S37P unknown Het
Lrrc4b T C 7: 44,462,594 V630A probably benign Het
Man2a2 C T 7: 80,360,923 W773* probably null Het
Mgrn1 T A 16: 4,915,766 L192Q probably damaging Het
Mtx1 A G 3: 89,214,171 V52A probably benign Het
Myc A T 15: 61,987,546 N24Y possibly damaging Het
Nbea G A 3: 55,643,655 S2696L possibly damaging Het
Nox4 A G 7: 87,374,384 N493D probably damaging Het
Olfr692 C A 7: 105,368,640 P105T probably benign Het
Osbpl10 G A 9: 115,223,593 G403D probably damaging Het
Pdcd6ip A T 9: 113,689,616 L192Q probably damaging Het
Pde3a A G 6: 141,481,221 I703V possibly damaging Het
Pkd1l3 CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA 8: 109,623,788 probably benign Het
Plcb3 A G 19: 6,966,703 S36P probably damaging Het
Plk5 T C 10: 80,360,345 F279L probably damaging Het
Prl7a1 T G 13: 27,637,655 E99D probably benign Het
Rnf4 C T 5: 34,351,357 R188W probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGAGGCGGCGG 7: 97,579,917 probably benign Het
Scel A G 14: 103,572,015 S264G probably benign Het
Sdk1 A G 5: 142,158,621 Q1712R possibly damaging Het
Slc15a1 A G 14: 121,480,703 Y255H probably benign Het
Syne1 C T 10: 5,043,615 G525D probably benign Het
Taldo1 T C 7: 141,401,875 V214A probably damaging Het
Tbc1d12 A G 19: 38,901,409 T428A probably damaging Het
Tlr6 T C 5: 64,955,112 K151E probably benign Het
Ubtf A C 11: 102,308,911 Y463D probably damaging Het
Uroc1 A T 6: 90,337,715 M106L probably damaging Het
Vmn1r55 T A 7: 5,146,870 I185L probably benign Het
Vmn2r93 T A 17: 18,304,968 V296D probably damaging Het
Zfp65 A C 13: 67,708,918 Y81D probably damaging Het
Zw10 A T 9: 49,077,483 Y683F possibly damaging Het
Other mutations in Ubr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Ubr2 APN 17 46986060 splice site probably benign
IGL00332:Ubr2 APN 17 46990990 critical splice donor site probably null
IGL00518:Ubr2 APN 17 46992996 missense probably damaging 1.00
IGL00693:Ubr2 APN 17 46972981 missense probably benign 0.01
IGL00785:Ubr2 APN 17 46944865 missense possibly damaging 0.69
IGL01144:Ubr2 APN 17 46957321 missense probably damaging 1.00
IGL01459:Ubr2 APN 17 46930509 splice site probably benign
IGL01637:Ubr2 APN 17 46956654 missense probably damaging 1.00
IGL01710:Ubr2 APN 17 46943409 missense probably benign 0.00
IGL01726:Ubr2 APN 17 46992981 splice site probably benign
IGL01925:Ubr2 APN 17 46954949 missense possibly damaging 0.92
IGL01960:Ubr2 APN 17 46973967 missense probably benign 0.45
IGL02170:Ubr2 APN 17 46967197 missense probably benign 0.05
IGL02308:Ubr2 APN 17 46934193 missense probably damaging 1.00
IGL02387:Ubr2 APN 17 46963150 missense probably benign
IGL02696:Ubr2 APN 17 46963765 missense probably benign
IGL02726:Ubr2 APN 17 46972921 missense probably damaging 1.00
IGL02750:Ubr2 APN 17 46969282 missense probably benign 0.00
IGL02934:Ubr2 APN 17 46957340 missense possibly damaging 0.50
IGL02959:Ubr2 APN 17 46975951 missense probably damaging 0.96
IGL03018:Ubr2 APN 17 46954046 missense possibly damaging 0.64
IGL03343:Ubr2 APN 17 46951918 missense probably benign 0.00
PIT4280001:Ubr2 UTSW 17 46944863 missense probably damaging 1.00
R0044:Ubr2 UTSW 17 46992985 splice site probably benign
R0044:Ubr2 UTSW 17 46992985 splice site probably benign
R0446:Ubr2 UTSW 17 46983298 missense probably damaging 1.00
R0513:Ubr2 UTSW 17 46986779 nonsense probably null
R0565:Ubr2 UTSW 17 46955886 missense probably damaging 1.00
R0600:Ubr2 UTSW 17 46967248 missense probably damaging 0.99
R0690:Ubr2 UTSW 17 46938653 missense probably damaging 0.97
R0710:Ubr2 UTSW 17 46938681 missense probably damaging 0.96
R0761:Ubr2 UTSW 17 46983316 missense probably damaging 1.00
R0798:Ubr2 UTSW 17 46969176 splice site probably benign
R0862:Ubr2 UTSW 17 46967083 nonsense probably null
R0947:Ubr2 UTSW 17 46941112 missense probably damaging 0.99
R0972:Ubr2 UTSW 17 46934261 splice site probably null
R1500:Ubr2 UTSW 17 46986689 missense possibly damaging 0.79
R1514:Ubr2 UTSW 17 47000823 missense probably damaging 1.00
R1533:Ubr2 UTSW 17 46967247 nonsense probably null
R1554:Ubr2 UTSW 17 46972951 missense probably benign
R1575:Ubr2 UTSW 17 46932492 missense probably damaging 1.00
R1602:Ubr2 UTSW 17 46941061 missense probably benign 0.30
R1941:Ubr2 UTSW 17 46974026 missense probably damaging 1.00
R1966:Ubr2 UTSW 17 46954919 missense probably benign 0.05
R2041:Ubr2 UTSW 17 46986047 missense probably damaging 1.00
R2067:Ubr2 UTSW 17 46963145 critical splice donor site probably null
R2111:Ubr2 UTSW 17 46963145 critical splice donor site probably null
R2189:Ubr2 UTSW 17 46943364 missense probably benign 0.01
R2219:Ubr2 UTSW 17 46986042 missense possibly damaging 0.94
R2307:Ubr2 UTSW 17 46966215 nonsense probably null
R3426:Ubr2 UTSW 17 46968439 missense probably damaging 1.00
R3428:Ubr2 UTSW 17 46968439 missense probably damaging 1.00
R3608:Ubr2 UTSW 17 46944523 missense probably damaging 1.00
R4080:Ubr2 UTSW 17 46988722 missense probably benign 0.05
R4330:Ubr2 UTSW 17 46967278 missense probably null 1.00
R4383:Ubr2 UTSW 17 46939387 missense probably benign 0.01
R4460:Ubr2 UTSW 17 46945045 critical splice donor site probably null
R4794:Ubr2 UTSW 17 46930445 missense probably damaging 1.00
R4902:Ubr2 UTSW 17 46985996 missense possibly damaging 0.91
R4913:Ubr2 UTSW 17 46959459 splice site probably null
R5092:Ubr2 UTSW 17 46969247 missense probably damaging 1.00
R5209:Ubr2 UTSW 17 46968424 missense probably damaging 1.00
R5226:Ubr2 UTSW 17 46983270 missense probably benign 0.04
R5250:Ubr2 UTSW 17 46930442 missense probably benign 0.01
R5437:Ubr2 UTSW 17 46963697 missense probably benign 0.00
R5607:Ubr2 UTSW 17 46934200 nonsense probably null
R5848:Ubr2 UTSW 17 46956655 missense possibly damaging 0.84
R6089:Ubr2 UTSW 17 46982292 missense possibly damaging 0.95
R6382:Ubr2 UTSW 17 46957315 missense possibly damaging 0.56
R6552:Ubr2 UTSW 17 46966268 splice site probably null
R6630:Ubr2 UTSW 17 46951984 missense possibly damaging 0.51
R6892:Ubr2 UTSW 17 46934108 missense probably damaging 0.99
R6936:Ubr2 UTSW 17 46973031 missense possibly damaging 0.94
R7039:Ubr2 UTSW 17 47010213 missense probably benign 0.01
R7050:Ubr2 UTSW 17 46961602 missense probably benign 0.30
R7078:Ubr2 UTSW 17 46955853 missense possibly damaging 0.59
R7126:Ubr2 UTSW 17 46974056 splice site probably null
R7219:Ubr2 UTSW 17 46935434 nonsense probably null
R7262:Ubr2 UTSW 17 47000739 missense probably damaging 0.97
R7352:Ubr2 UTSW 17 46930426 missense probably benign 0.19
R7366:Ubr2 UTSW 17 46955845 missense probably damaging 0.99
R7449:Ubr2 UTSW 17 46964788 missense probably damaging 1.00
R7496:Ubr2 UTSW 17 46990991 critical splice donor site probably null
R7759:Ubr2 UTSW 17 46986048 missense probably damaging 1.00
R7869:Ubr2 UTSW 17 46991008 missense probably benign 0.00
R7916:Ubr2 UTSW 17 46968382 critical splice donor site probably null
R8236:Ubr2 UTSW 17 46951909 missense probably benign
X0027:Ubr2 UTSW 17 47000629 missense probably damaging 0.99
X0061:Ubr2 UTSW 17 46970111 missense possibly damaging 0.88
Z1177:Ubr2 UTSW 17 46959509 missense probably benign
Z1177:Ubr2 UTSW 17 47000766 missense possibly damaging 0.76
Z1177:Ubr2 UTSW 17 47010143 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TTCTTACACATCCATGCACAGC -3'
(R):5'- TATAATGGCTGGTTCACCGG -3'

Sequencing Primer
(F):5'- TTACACATCCATGCACAGCAACTTC -3'
(R):5'- GGGGATCCATACTATGTGCAC -3'
Posted On2020-09-02