Incidental Mutation 'R8377:F11r'
ID646718
Institutional Source Beutler Lab
Gene Symbol F11r
Ensembl Gene ENSMUSG00000038235
Gene NameF11 receptor
SynonymsJcam1, JAM-A, Ly106, ESTM33, BV11 antigen, JAM-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R8377 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location171437535-171464603 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) G to T at 171437543 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000041907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043839]
PDB Structure
SOLUBLE PART OF THE JUNCTION ADHESION MOLECULE FROM MOUSE [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000043839
SMART Domains Protein: ENSMUSP00000041907
Gene: ENSMUSG00000038235

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IGv 44 110 9.93e-8 SMART
IGc2 143 219 1.82e-6 SMART
transmembrane domain 239 261 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. The protein encoded by this immunoglobulin superfamily gene member is an important regulator of tight junction assembly in epithelia. In addition, the encoded protein can act as (1) a receptor for reovirus, (2) a ligand for the integrin LFA1, involved in leukocyte transmigration, and (3) a platelet receptor. Multiple 5' alternatively spliced variants, encoding the same protein, have been identified but their biological validity has not been established. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display increased dendritic cell migratory ability and contact hypersensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
Acot3 C A 12: 84,058,787 C251* probably null Het
Acsbg1 A G 9: 54,622,505 C273R probably damaging Het
Adh6a A G 3: 138,326,123 T259A probably damaging Het
Aknad1 A G 3: 108,781,939 H639R possibly damaging Het
Alkal2 G T 12: 30,884,851 G23V probably damaging Het
Ampd3 A G 7: 110,800,730 R342G probably damaging Het
Arid5b G T 10: 68,097,387 A895E probably damaging Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Bmp8a G T 4: 123,342,689 P7Q unknown Het
Boll A C 1: 55,323,678 V187G possibly damaging Het
Ccdc162 A T 10: 41,581,310 C1544S probably benign Het
Cmss1 A C 16: 57,307,394 M182R possibly damaging Het
Cntn3 T C 6: 102,209,293 M578V probably benign Het
Dmxl2 A T 9: 54,378,748 W2718R probably damaging Het
Dsg1a T A 18: 20,333,774 I567N probably damaging Het
Epc2 T A 2: 49,522,515 D168E probably damaging Het
Ern2 G A 7: 122,181,292 Q162* probably null Het
Fam196b C A 11: 34,401,964 A2D probably damaging Het
Fcgrt T C 7: 45,102,563 Y59C probably damaging Het
Fmn2 G T 1: 174,608,445 E661* probably null Het
Gbp4 T A 5: 105,118,462 Q571L probably benign Het
Gm29106 A T 1: 118,198,863 H95L probably damaging Het
Gphn G A 12: 78,664,506 V621M probably damaging Het
Grwd1 T C 7: 45,830,612 Y57C probably damaging Het
Irs2 G A 8: 11,004,848 Q1195* probably null Het
Itpr1 G C 6: 108,510,738 C2375S probably benign Het
Kcnmb4 A T 10: 116,446,385 Y136N probably benign Het
Matn2 C T 15: 34,345,365 P173S probably damaging Het
Med17 A C 9: 15,262,359 D606E probably damaging Het
Mpl A G 4: 118,444,057 V537A Het
Mrpl1 C G 5: 96,226,367 A167G probably benign Het
Mrpl21 T C 19: 3,292,487 F206S unknown Het
Msh6 T A 17: 87,985,170 M451K probably damaging Het
Myo10 T C 15: 25,804,395 I1592T possibly damaging Het
Naip1 A T 13: 100,425,866 D930E possibly damaging Het
Necap2 T C 4: 141,068,223 I242V probably benign Het
Nfya A G 17: 48,392,045 V240A possibly damaging Het
Olfml2b A G 1: 170,668,784 D328G probably damaging Het
Olfr1277 T A 2: 111,269,638 H243L probably damaging Het
Olfr1337 A T 4: 118,782,006 M193K probably benign Het
Olfr1449 T G 19: 12,935,035 V99G probably benign Het
Olfr473 T G 7: 107,933,685 L55R probably damaging Het
Pkd1l3 T C 8: 109,635,350 V1018A probably benign Het
Plcg1 T C 2: 160,754,922 L761P probably damaging Het
Ppp1r36 T C 12: 76,438,441 S313P possibly damaging Het
Ptpru C A 4: 131,808,335 G444C probably damaging Het
Rfxank A T 8: 70,135,310 V149D probably damaging Het
Rimbp2 G A 5: 128,780,331 H819Y probably damaging Het
Sgms1 T C 19: 32,124,421 Y395C probably damaging Het
Siae G A 9: 37,631,605 probably null Het
Slc46a2 T A 4: 59,914,713 D70V probably damaging Het
Smpdl3a A C 10: 57,800,936 L43F possibly damaging Het
Spcs1 T A 14: 31,000,146 D146V possibly damaging Het
Srcin1 T C 11: 97,551,978 D8G probably damaging Het
Stra6 G T 9: 58,149,205 L373F probably damaging Het
Tacc1 A T 8: 25,182,283 S310T possibly damaging Het
Tlr12 T C 4: 128,615,773 S895G probably benign Het
Tnfaip3 A G 10: 19,011,510 V89A probably damaging Het
Top1 C T 2: 160,646,089 probably benign Het
Trappc13 T G 13: 104,161,001 I132L probably benign Het
Trpt1 C T 19: 6,998,981 Q249* probably null Het
Tsnaxip1 A C 8: 105,842,547 K510Q probably damaging Het
Usp39 A T 6: 72,328,674 N375K probably benign Het
Vldlr T A 19: 27,234,858 C91S probably damaging Het
Vmn1r232 T A 17: 20,913,977 L120F probably benign Het
Vmn2r71 T C 7: 85,615,499 V13A probably benign Het
Wdr11 T A 7: 129,606,688 V389E possibly damaging Het
Wsb2 A T 5: 117,376,701 I321F possibly damaging Het
Zan A T 5: 137,391,687 V4841E unknown Het
Zfy1 A T Y: 725,723 F681I possibly damaging Het
Zpld1 C A 16: 55,246,654 E179D probably benign Het
Other mutations in F11r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:F11r APN 1 171462942 critical splice donor site probably null
IGL01431:F11r APN 1 171462909 missense probably damaging 1.00
R0481:F11r UTSW 1 171461279 missense probably benign 0.02
R0486:F11r UTSW 1 171460588 missense probably damaging 1.00
R1944:F11r UTSW 1 171461891 missense probably damaging 1.00
R1984:F11r UTSW 1 171461870 missense probably benign 0.02
R2423:F11r UTSW 1 171461623 missense possibly damaging 0.89
R3545:F11r UTSW 1 171461261 missense probably damaging 1.00
R3840:F11r UTSW 1 171460889 missense probably damaging 1.00
R3841:F11r UTSW 1 171460889 missense probably damaging 1.00
R4007:F11r UTSW 1 171461348 missense probably benign 0.35
R4744:F11r UTSW 1 171460598 missense probably benign 0.00
R4775:F11r UTSW 1 171461641 missense probably damaging 1.00
R6384:F11r UTSW 1 171460940 missense probably benign 0.01
R8052:F11r UTSW 1 171461623 missense possibly damaging 0.89
R8215:F11r UTSW 1 171463088 makesense probably null
R8217:F11r UTSW 1 171463088 makesense probably null
RF063:F11r UTSW 1 171461190 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- CAATTGGGATGCCCTTACCTGC -3'
(R):5'- GGAACTCACCCAGGATCATAG -3'

Sequencing Primer
(F):5'- CTTTAAGCGACAGTCTCCTGGG -3'
(R):5'- TCACCCAGGATCATAGACGTG -3'
Posted On2020-09-02