Incidental Mutation 'R8377:Ptpru'
ID646731
Institutional Source Beutler Lab
Gene Symbol Ptpru
Ensembl Gene ENSMUSG00000028909
Gene Nameprotein tyrosine phosphatase, receptor type, U
SynonymsPtprl, RPTPlambda
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8377 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location131768457-131838288 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 131808335 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 444 (G444C)
Ref Sequence ENSEMBL: ENSMUSP00000101607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030741] [ENSMUST00000097860] [ENSMUST00000105987]
Predicted Effect probably damaging
Transcript: ENSMUST00000030741
AA Change: G444C

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030741
Gene: ENSMUSG00000028909
AA Change: G444C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
MAM 22 188 5.58e-68 SMART
IG 195 283 4.93e-3 SMART
FN3 285 368 3.79e-2 SMART
FN3 384 472 2.5e-2 SMART
FN3 488 576 3.62e-8 SMART
low complexity region 627 641 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
transmembrane domain 747 769 N/A INTRINSIC
PTPc 893 1146 5.95e-102 SMART
PTPc 1175 1441 3.67e-93 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097860
AA Change: G372C

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095472
Gene: ENSMUSG00000028909
AA Change: G372C

DomainStartEndE-ValueType
Pfam:MAM 1 116 4.1e-30 PFAM
IG 123 211 4.93e-3 SMART
FN3 213 296 3.79e-2 SMART
FN3 312 400 2.5e-2 SMART
FN3 416 504 3.62e-8 SMART
low complexity region 555 569 N/A INTRINSIC
low complexity region 595 605 N/A INTRINSIC
transmembrane domain 675 697 N/A INTRINSIC
Blast:PTPc 736 878 3e-49 BLAST
SCOP:d1jlna_ 790 886 9e-19 SMART
PDB:2C7S|A 797 878 7e-22 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000105987
AA Change: G444C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101607
Gene: ENSMUSG00000028909
AA Change: G444C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
MAM 22 188 5.58e-68 SMART
IG 195 283 4.93e-3 SMART
FN3 285 368 3.79e-2 SMART
FN3 384 472 2.5e-2 SMART
FN3 488 576 3.62e-8 SMART
low complexity region 627 641 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
transmembrane domain 748 770 N/A INTRINSIC
PTPc 883 1136 5.95e-102 SMART
PTPc 1165 1431 3.67e-93 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. This PTP was thought to play roles in cell-cell recognition and adhesion. Studies of the similar gene in mice suggested the role of this PTP in early neural development. The expression of this gene was reported to be regulated by phorbol myristate acetate (PMA) or calcium ionophore in Jurkat T lymphoma cells. Alternatively spliced transcript variants have been reported. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
Acot3 C A 12: 84,058,787 C251* probably null Het
Acsbg1 A G 9: 54,622,505 C273R probably damaging Het
Adh6a A G 3: 138,326,123 T259A probably damaging Het
Aknad1 A G 3: 108,781,939 H639R possibly damaging Het
Alkal2 G T 12: 30,884,851 G23V probably damaging Het
Ampd3 A G 7: 110,800,730 R342G probably damaging Het
Arid5b G T 10: 68,097,387 A895E probably damaging Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Bmp8a G T 4: 123,342,689 P7Q unknown Het
Boll A C 1: 55,323,678 V187G possibly damaging Het
Ccdc162 A T 10: 41,581,310 C1544S probably benign Het
Cmss1 A C 16: 57,307,394 M182R possibly damaging Het
Cntn3 T C 6: 102,209,293 M578V probably benign Het
Dmxl2 A T 9: 54,378,748 W2718R probably damaging Het
Dsg1a T A 18: 20,333,774 I567N probably damaging Het
Epc2 T A 2: 49,522,515 D168E probably damaging Het
Ern2 G A 7: 122,181,292 Q162* probably null Het
F11r G T 1: 171,437,543 probably benign Het
Fam196b C A 11: 34,401,964 A2D probably damaging Het
Fcgrt T C 7: 45,102,563 Y59C probably damaging Het
Fmn2 G T 1: 174,608,445 E661* probably null Het
Gbp4 T A 5: 105,118,462 Q571L probably benign Het
Gm29106 A T 1: 118,198,863 H95L probably damaging Het
Gphn G A 12: 78,664,506 V621M probably damaging Het
Grwd1 T C 7: 45,830,612 Y57C probably damaging Het
Irs2 G A 8: 11,004,848 Q1195* probably null Het
Itpr1 G C 6: 108,510,738 C2375S probably benign Het
Kcnmb4 A T 10: 116,446,385 Y136N probably benign Het
Matn2 C T 15: 34,345,365 P173S probably damaging Het
Med17 A C 9: 15,262,359 D606E probably damaging Het
Mpl A G 4: 118,444,057 V537A Het
Mrpl1 C G 5: 96,226,367 A167G probably benign Het
Mrpl21 T C 19: 3,292,487 F206S unknown Het
Msh6 T A 17: 87,985,170 M451K probably damaging Het
Myo10 T C 15: 25,804,395 I1592T possibly damaging Het
Naip1 A T 13: 100,425,866 D930E possibly damaging Het
Necap2 T C 4: 141,068,223 I242V probably benign Het
Nfya A G 17: 48,392,045 V240A possibly damaging Het
Olfml2b A G 1: 170,668,784 D328G probably damaging Het
Olfr1277 T A 2: 111,269,638 H243L probably damaging Het
Olfr1337 A T 4: 118,782,006 M193K probably benign Het
Olfr1449 T G 19: 12,935,035 V99G probably benign Het
Olfr473 T G 7: 107,933,685 L55R probably damaging Het
Pkd1l3 T C 8: 109,635,350 V1018A probably benign Het
Plcg1 T C 2: 160,754,922 L761P probably damaging Het
Ppp1r36 T C 12: 76,438,441 S313P possibly damaging Het
Rfxank A T 8: 70,135,310 V149D probably damaging Het
Rimbp2 G A 5: 128,780,331 H819Y probably damaging Het
Sgms1 T C 19: 32,124,421 Y395C probably damaging Het
Siae G A 9: 37,631,605 probably null Het
Slc46a2 T A 4: 59,914,713 D70V probably damaging Het
Smpdl3a A C 10: 57,800,936 L43F possibly damaging Het
Spcs1 T A 14: 31,000,146 D146V possibly damaging Het
Srcin1 T C 11: 97,551,978 D8G probably damaging Het
Stra6 G T 9: 58,149,205 L373F probably damaging Het
Tacc1 A T 8: 25,182,283 S310T possibly damaging Het
Tlr12 T C 4: 128,615,773 S895G probably benign Het
Tnfaip3 A G 10: 19,011,510 V89A probably damaging Het
Top1 C T 2: 160,646,089 probably benign Het
Trappc13 T G 13: 104,161,001 I132L probably benign Het
Trpt1 C T 19: 6,998,981 Q249* probably null Het
Tsnaxip1 A C 8: 105,842,547 K510Q probably damaging Het
Usp39 A T 6: 72,328,674 N375K probably benign Het
Vldlr T A 19: 27,234,858 C91S probably damaging Het
Vmn1r232 T A 17: 20,913,977 L120F probably benign Het
Vmn2r71 T C 7: 85,615,499 V13A probably benign Het
Wdr11 T A 7: 129,606,688 V389E possibly damaging Het
Wsb2 A T 5: 117,376,701 I321F possibly damaging Het
Zan A T 5: 137,391,687 V4841E unknown Het
Zfy1 A T Y: 725,723 F681I possibly damaging Het
Zpld1 C A 16: 55,246,654 E179D probably benign Het
Other mutations in Ptpru
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Ptpru APN 4 131808235 missense probably benign 0.00
IGL00966:Ptpru APN 4 131772616 missense probably damaging 1.00
IGL01451:Ptpru APN 4 131769492 utr 3 prime probably benign
IGL01453:Ptpru APN 4 131769492 utr 3 prime probably benign
IGL01606:Ptpru APN 4 131808481 missense possibly damaging 0.69
IGL02451:Ptpru APN 4 131776775 splice site probably benign
IGL03135:Ptpru APN 4 131818800 missense probably damaging 0.97
IGL03366:Ptpru APN 4 131779867 missense probably damaging 1.00
PIT4366001:Ptpru UTSW 4 131799712 missense probably benign 0.03
PIT4576001:Ptpru UTSW 4 131802544 nonsense probably null
R0299:Ptpru UTSW 4 131803387 nonsense probably null
R0458:Ptpru UTSW 4 131799675 missense possibly damaging 0.49
R0502:Ptpru UTSW 4 131793643 missense probably benign 0.02
R0503:Ptpru UTSW 4 131793643 missense probably benign 0.02
R0619:Ptpru UTSW 4 131820887 missense possibly damaging 0.91
R0639:Ptpru UTSW 4 131771179 missense possibly damaging 0.49
R0843:Ptpru UTSW 4 131797948 missense probably benign 0.10
R1065:Ptpru UTSW 4 131808340 missense possibly damaging 0.49
R1170:Ptpru UTSW 4 131808527 splice site probably benign
R1382:Ptpru UTSW 4 131808229 missense probably damaging 0.98
R1442:Ptpru UTSW 4 131808269 missense probably benign 0.00
R1538:Ptpru UTSW 4 131774351 missense probably damaging 0.99
R1624:Ptpru UTSW 4 131772550 missense probably damaging 1.00
R1688:Ptpru UTSW 4 131787345 missense probably benign 0.01
R1699:Ptpru UTSW 4 131779050 missense probably damaging 1.00
R1740:Ptpru UTSW 4 131793678 splice site probably null
R1874:Ptpru UTSW 4 131769755 missense probably benign
R1959:Ptpru UTSW 4 131803477 missense probably damaging 1.00
R2051:Ptpru UTSW 4 131819087 missense possibly damaging 0.80
R2200:Ptpru UTSW 4 131820813 missense probably damaging 1.00
R2281:Ptpru UTSW 4 131808499 missense probably damaging 1.00
R2304:Ptpru UTSW 4 131772568 missense probably damaging 1.00
R2411:Ptpru UTSW 4 131771469 missense probably damaging 1.00
R2845:Ptpru UTSW 4 131819661 missense probably benign 0.00
R3767:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3768:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3769:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3770:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3937:Ptpru UTSW 4 131774304 missense probably damaging 0.99
R4079:Ptpru UTSW 4 131798710 critical splice donor site probably null
R4110:Ptpru UTSW 4 131819037 missense probably damaging 1.00
R4170:Ptpru UTSW 4 131776348 missense probably damaging 1.00
R4716:Ptpru UTSW 4 131820968 missense probably benign
R4751:Ptpru UTSW 4 131802586 missense probably damaging 0.97
R4766:Ptpru UTSW 4 131820964 missense probably damaging 1.00
R4825:Ptpru UTSW 4 131799603 missense probably benign
R4900:Ptpru UTSW 4 131788382 missense probably damaging 0.99
R4998:Ptpru UTSW 4 131776885 missense probably damaging 1.00
R5279:Ptpru UTSW 4 131820023 missense possibly damaging 0.62
R5464:Ptpru UTSW 4 131772557 missense probably damaging 1.00
R5625:Ptpru UTSW 4 131803380 missense probably null 1.00
R5667:Ptpru UTSW 4 131820190 missense possibly damaging 0.94
R5671:Ptpru UTSW 4 131820190 missense possibly damaging 0.94
R5735:Ptpru UTSW 4 131838090 missense probably benign 0.01
R5802:Ptpru UTSW 4 131788377 missense possibly damaging 0.84
R5809:Ptpru UTSW 4 131785756 missense probably benign 0.34
R5953:Ptpru UTSW 4 131776837 missense probably damaging 1.00
R5973:Ptpru UTSW 4 131818925 missense probably benign 0.00
R6029:Ptpru UTSW 4 131771293 missense probably damaging 1.00
R6072:Ptpru UTSW 4 131776228 missense probably damaging 0.99
R6089:Ptpru UTSW 4 131772630 missense possibly damaging 0.94
R6174:Ptpru UTSW 4 131785754 missense probably benign
R6177:Ptpru UTSW 4 131793525 missense probably benign 0.00
R6367:Ptpru UTSW 4 131774352 missense probably benign 0.18
R6682:Ptpru UTSW 4 131820782 missense probably benign
R6950:Ptpru UTSW 4 131776352 missense probably damaging 0.99
R7159:Ptpru UTSW 4 131819540 missense probably damaging 1.00
R7736:Ptpru UTSW 4 131788382 missense probably damaging 1.00
R7960:Ptpru UTSW 4 131788509 missense probably benign 0.01
R8094:Ptpru UTSW 4 131793592 missense possibly damaging 0.88
R8262:Ptpru UTSW 4 131794963 nonsense probably null
R8276:Ptpru UTSW 4 131779173 missense probably damaging 1.00
R8416:Ptpru UTSW 4 131808472 missense probably damaging 1.00
X0024:Ptpru UTSW 4 131771190 missense probably benign 0.15
Z1177:Ptpru UTSW 4 131799706 missense probably benign 0.00
Z1177:Ptpru UTSW 4 131808262 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTCACCATTACGTTCCTATAGTCC -3'
(R):5'- TGCTTCCTGTGTCTCCAGAG -3'

Sequencing Primer
(F):5'- TATAGTCCCCTACATGAATCTGAGC -3'
(R):5'- TGTGTCTCCAGAGCCCAC -3'
Posted On2020-09-02