Incidental Mutation 'R8377:Usp39'
ID646738
Institutional Source Beutler Lab
Gene Symbol Usp39
Ensembl Gene ENSMUSG00000056305
Gene Nameubiquitin specific peptidase 39
SynonymsSAD1, CGI-21, D6Wsu157e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R8377 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location72318678-72345184 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 72328674 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 375 (N375K)
Ref Sequence ENSEMBL: ENSMUSP00000064515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070345]
Predicted Effect probably benign
Transcript: ENSMUST00000070345
AA Change: N375K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000064515
Gene: ENSMUSG00000056305
AA Change: N375K

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 48 73 N/A INTRINSIC
ZnF_C2H2 133 154 5.07e0 SMART
Pfam:UCH 223 551 3.9e-45 PFAM
Pfam:UCH_1 224 533 1.3e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
Acot3 C A 12: 84,058,787 C251* probably null Het
Acsbg1 A G 9: 54,622,505 C273R probably damaging Het
Adh6a A G 3: 138,326,123 T259A probably damaging Het
Aknad1 A G 3: 108,781,939 H639R possibly damaging Het
Alkal2 G T 12: 30,884,851 G23V probably damaging Het
Ampd3 A G 7: 110,800,730 R342G probably damaging Het
Arid5b G T 10: 68,097,387 A895E probably damaging Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Bmp8a G T 4: 123,342,689 P7Q unknown Het
Boll A C 1: 55,323,678 V187G possibly damaging Het
Ccdc162 A T 10: 41,581,310 C1544S probably benign Het
Cmss1 A C 16: 57,307,394 M182R possibly damaging Het
Cntn3 T C 6: 102,209,293 M578V probably benign Het
Dmxl2 A T 9: 54,378,748 W2718R probably damaging Het
Dsg1a T A 18: 20,333,774 I567N probably damaging Het
Epc2 T A 2: 49,522,515 D168E probably damaging Het
Ern2 G A 7: 122,181,292 Q162* probably null Het
F11r G T 1: 171,437,543 probably benign Het
Fam196b C A 11: 34,401,964 A2D probably damaging Het
Fcgrt T C 7: 45,102,563 Y59C probably damaging Het
Fmn2 G T 1: 174,608,445 E661* probably null Het
Gbp4 T A 5: 105,118,462 Q571L probably benign Het
Gm29106 A T 1: 118,198,863 H95L probably damaging Het
Gphn G A 12: 78,664,506 V621M probably damaging Het
Grwd1 T C 7: 45,830,612 Y57C probably damaging Het
Irs2 G A 8: 11,004,848 Q1195* probably null Het
Itpr1 G C 6: 108,510,738 C2375S probably benign Het
Kcnmb4 A T 10: 116,446,385 Y136N probably benign Het
Matn2 C T 15: 34,345,365 P173S probably damaging Het
Med17 A C 9: 15,262,359 D606E probably damaging Het
Mpl A G 4: 118,444,057 V537A Het
Mrpl1 C G 5: 96,226,367 A167G probably benign Het
Mrpl21 T C 19: 3,292,487 F206S unknown Het
Msh6 T A 17: 87,985,170 M451K probably damaging Het
Myo10 T C 15: 25,804,395 I1592T possibly damaging Het
Naip1 A T 13: 100,425,866 D930E possibly damaging Het
Necap2 T C 4: 141,068,223 I242V probably benign Het
Nfya A G 17: 48,392,045 V240A possibly damaging Het
Olfml2b A G 1: 170,668,784 D328G probably damaging Het
Olfr1277 T A 2: 111,269,638 H243L probably damaging Het
Olfr1337 A T 4: 118,782,006 M193K probably benign Het
Olfr1449 T G 19: 12,935,035 V99G probably benign Het
Olfr473 T G 7: 107,933,685 L55R probably damaging Het
Pkd1l3 T C 8: 109,635,350 V1018A probably benign Het
Plcg1 T C 2: 160,754,922 L761P probably damaging Het
Ppp1r36 T C 12: 76,438,441 S313P possibly damaging Het
Ptpru C A 4: 131,808,335 G444C probably damaging Het
Rfxank A T 8: 70,135,310 V149D probably damaging Het
Rimbp2 G A 5: 128,780,331 H819Y probably damaging Het
Sgms1 T C 19: 32,124,421 Y395C probably damaging Het
Siae G A 9: 37,631,605 probably null Het
Slc46a2 T A 4: 59,914,713 D70V probably damaging Het
Smpdl3a A C 10: 57,800,936 L43F possibly damaging Het
Spcs1 T A 14: 31,000,146 D146V possibly damaging Het
Srcin1 T C 11: 97,551,978 D8G probably damaging Het
Stra6 G T 9: 58,149,205 L373F probably damaging Het
Tacc1 A T 8: 25,182,283 S310T possibly damaging Het
Tlr12 T C 4: 128,615,773 S895G probably benign Het
Tnfaip3 A G 10: 19,011,510 V89A probably damaging Het
Top1 C T 2: 160,646,089 probably benign Het
Trappc13 T G 13: 104,161,001 I132L probably benign Het
Trpt1 C T 19: 6,998,981 Q249* probably null Het
Tsnaxip1 A C 8: 105,842,547 K510Q probably damaging Het
Vldlr T A 19: 27,234,858 C91S probably damaging Het
Vmn1r232 T A 17: 20,913,977 L120F probably benign Het
Vmn2r71 T C 7: 85,615,499 V13A probably benign Het
Wdr11 T A 7: 129,606,688 V389E possibly damaging Het
Wsb2 A T 5: 117,376,701 I321F possibly damaging Het
Zan A T 5: 137,391,687 V4841E unknown Het
Zfy1 A T Y: 725,723 F681I possibly damaging Het
Zpld1 C A 16: 55,246,654 E179D probably benign Het
Other mutations in Usp39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Usp39 APN 6 72328624 missense probably damaging 0.99
IGL01065:Usp39 APN 6 72339975 missense probably damaging 1.00
IGL01669:Usp39 APN 6 72338493 missense probably damaging 0.99
IGL03089:Usp39 APN 6 72328639 missense probably damaging 1.00
IGL03397:Usp39 APN 6 72336313 missense possibly damaging 0.53
R0561:Usp39 UTSW 6 72336385 missense probably damaging 1.00
R3236:Usp39 UTSW 6 72338389 splice site probably benign
R3552:Usp39 UTSW 6 72337832 missense possibly damaging 0.63
R4010:Usp39 UTSW 6 72336485 missense probably benign 0.44
R4854:Usp39 UTSW 6 72325682 missense probably benign 0.29
R5502:Usp39 UTSW 6 72328687 missense probably benign
R6868:Usp39 UTSW 6 72337751 missense possibly damaging 0.93
R6887:Usp39 UTSW 6 72333157 missense probably damaging 1.00
R7313:Usp39 UTSW 6 72336430 missense probably benign 0.00
R7429:Usp39 UTSW 6 72342917 missense probably damaging 1.00
R7430:Usp39 UTSW 6 72342917 missense probably damaging 1.00
R7431:Usp39 UTSW 6 72336268 missense possibly damaging 0.66
R7544:Usp39 UTSW 6 72342908 missense probably damaging 1.00
R7548:Usp39 UTSW 6 72345013 missense possibly damaging 0.93
R7741:Usp39 UTSW 6 72338538 splice site probably benign
R8405:Usp39 UTSW 6 72328538 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAGCTTGCCTTCTACGTC -3'
(R):5'- GGGCTGGTTCTGAATTCAGC -3'

Sequencing Primer
(F):5'- GCCCTGCCGCTAACACTATG -3'
(R):5'- CTGCCTGAGCTCTGGACTAAAG -3'
Posted On2020-09-02