Incidental Mutation 'R8377:Tsnaxip1'
ID646752
Institutional Source Beutler Lab
Gene Symbol Tsnaxip1
Ensembl Gene ENSMUSG00000031893
Gene Nametranslin-associated factor X (Tsnax) interacting protein 1
Synonyms1700016K08Rik, TXI1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.509) question?
Stock #R8377 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location105827731-105844680 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 105842547 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 510 (K510Q)
Ref Sequence ENSEMBL: ENSMUSP00000034365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034365] [ENSMUST00000040776] [ENSMUST00000212431] [ENSMUST00000212566]
Predicted Effect probably damaging
Transcript: ENSMUST00000034365
AA Change: K510Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034365
Gene: ENSMUSG00000031893
AA Change: K510Q

DomainStartEndE-ValueType
Pfam:TSNAXIP1_N 98 209 3.5e-33 PFAM
coiled coil region 304 342 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040776
SMART Domains Protein: ENSMUSP00000038188
Gene: ENSMUSG00000036672

DomainStartEndE-ValueType
Pfam:CENP-T_N 1 374 4.2e-174 PFAM
Pfam:CENP-T_C 404 507 5.4e-36 PFAM
Pfam:CENP-S 424 479 3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212431
Predicted Effect probably damaging
Transcript: ENSMUST00000212566
AA Change: K510Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
Acot3 C A 12: 84,058,787 C251* probably null Het
Acsbg1 A G 9: 54,622,505 C273R probably damaging Het
Adh6a A G 3: 138,326,123 T259A probably damaging Het
Aknad1 A G 3: 108,781,939 H639R possibly damaging Het
Alkal2 G T 12: 30,884,851 G23V probably damaging Het
Ampd3 A G 7: 110,800,730 R342G probably damaging Het
Arid5b G T 10: 68,097,387 A895E probably damaging Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Bmp8a G T 4: 123,342,689 P7Q unknown Het
Boll A C 1: 55,323,678 V187G possibly damaging Het
Ccdc162 A T 10: 41,581,310 C1544S probably benign Het
Cmss1 A C 16: 57,307,394 M182R possibly damaging Het
Cntn3 T C 6: 102,209,293 M578V probably benign Het
Dmxl2 A T 9: 54,378,748 W2718R probably damaging Het
Dsg1a T A 18: 20,333,774 I567N probably damaging Het
Epc2 T A 2: 49,522,515 D168E probably damaging Het
Ern2 G A 7: 122,181,292 Q162* probably null Het
F11r G T 1: 171,437,543 probably benign Het
Fam196b C A 11: 34,401,964 A2D probably damaging Het
Fcgrt T C 7: 45,102,563 Y59C probably damaging Het
Fmn2 G T 1: 174,608,445 E661* probably null Het
Gbp4 T A 5: 105,118,462 Q571L probably benign Het
Gm29106 A T 1: 118,198,863 H95L probably damaging Het
Gphn G A 12: 78,664,506 V621M probably damaging Het
Grwd1 T C 7: 45,830,612 Y57C probably damaging Het
Irs2 G A 8: 11,004,848 Q1195* probably null Het
Itpr1 G C 6: 108,510,738 C2375S probably benign Het
Kcnmb4 A T 10: 116,446,385 Y136N probably benign Het
Matn2 C T 15: 34,345,365 P173S probably damaging Het
Med17 A C 9: 15,262,359 D606E probably damaging Het
Mpl A G 4: 118,444,057 V537A Het
Mrpl1 C G 5: 96,226,367 A167G probably benign Het
Mrpl21 T C 19: 3,292,487 F206S unknown Het
Msh6 T A 17: 87,985,170 M451K probably damaging Het
Myo10 T C 15: 25,804,395 I1592T possibly damaging Het
Naip1 A T 13: 100,425,866 D930E possibly damaging Het
Necap2 T C 4: 141,068,223 I242V probably benign Het
Nfya A G 17: 48,392,045 V240A possibly damaging Het
Olfml2b A G 1: 170,668,784 D328G probably damaging Het
Olfr1277 T A 2: 111,269,638 H243L probably damaging Het
Olfr1337 A T 4: 118,782,006 M193K probably benign Het
Olfr1449 T G 19: 12,935,035 V99G probably benign Het
Olfr473 T G 7: 107,933,685 L55R probably damaging Het
Pkd1l3 T C 8: 109,635,350 V1018A probably benign Het
Plcg1 T C 2: 160,754,922 L761P probably damaging Het
Ppp1r36 T C 12: 76,438,441 S313P possibly damaging Het
Ptpru C A 4: 131,808,335 G444C probably damaging Het
Rfxank A T 8: 70,135,310 V149D probably damaging Het
Rimbp2 G A 5: 128,780,331 H819Y probably damaging Het
Sgms1 T C 19: 32,124,421 Y395C probably damaging Het
Siae G A 9: 37,631,605 probably null Het
Slc46a2 T A 4: 59,914,713 D70V probably damaging Het
Smpdl3a A C 10: 57,800,936 L43F possibly damaging Het
Spcs1 T A 14: 31,000,146 D146V possibly damaging Het
Srcin1 T C 11: 97,551,978 D8G probably damaging Het
Stra6 G T 9: 58,149,205 L373F probably damaging Het
Tacc1 A T 8: 25,182,283 S310T possibly damaging Het
Tlr12 T C 4: 128,615,773 S895G probably benign Het
Tnfaip3 A G 10: 19,011,510 V89A probably damaging Het
Top1 C T 2: 160,646,089 probably benign Het
Trappc13 T G 13: 104,161,001 I132L probably benign Het
Trpt1 C T 19: 6,998,981 Q249* probably null Het
Usp39 A T 6: 72,328,674 N375K probably benign Het
Vldlr T A 19: 27,234,858 C91S probably damaging Het
Vmn1r232 T A 17: 20,913,977 L120F probably benign Het
Vmn2r71 T C 7: 85,615,499 V13A probably benign Het
Wdr11 T A 7: 129,606,688 V389E possibly damaging Het
Wsb2 A T 5: 117,376,701 I321F possibly damaging Het
Zan A T 5: 137,391,687 V4841E unknown Het
Zfy1 A T Y: 725,723 F681I possibly damaging Het
Zpld1 C A 16: 55,246,654 E179D probably benign Het
Other mutations in Tsnaxip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Tsnaxip1 APN 8 105841423 missense probably benign 0.04
IGL00490:Tsnaxip1 APN 8 105842184 missense probably damaging 1.00
IGL00849:Tsnaxip1 APN 8 105842168 missense probably damaging 0.99
IGL01756:Tsnaxip1 APN 8 105842788 splice site probably benign
IGL01821:Tsnaxip1 APN 8 105837516 missense probably damaging 0.96
IGL02278:Tsnaxip1 APN 8 105827781 utr 5 prime probably benign
IGL02290:Tsnaxip1 APN 8 105833487 missense probably benign 0.00
IGL02980:Tsnaxip1 UTSW 8 105842210 missense probably damaging 0.96
R0239:Tsnaxip1 UTSW 8 105844488 missense possibly damaging 0.96
R0239:Tsnaxip1 UTSW 8 105844488 missense possibly damaging 0.96
R1544:Tsnaxip1 UTSW 8 105827751 start gained probably benign
R1939:Tsnaxip1 UTSW 8 105840038 missense probably benign 0.04
R3024:Tsnaxip1 UTSW 8 105841743 missense probably damaging 1.00
R3695:Tsnaxip1 UTSW 8 105833535 missense possibly damaging 0.61
R3853:Tsnaxip1 UTSW 8 105840701 splice site probably benign
R4044:Tsnaxip1 UTSW 8 105833545 splice site probably null
R4376:Tsnaxip1 UTSW 8 105841801 nonsense probably null
R4627:Tsnaxip1 UTSW 8 105841407 missense probably damaging 1.00
R4790:Tsnaxip1 UTSW 8 105833523 missense probably benign 0.12
R5806:Tsnaxip1 UTSW 8 105837496 missense possibly damaging 0.83
R5814:Tsnaxip1 UTSW 8 105843971 missense probably benign 0.00
R6045:Tsnaxip1 UTSW 8 105844187 missense probably benign 0.24
R6374:Tsnaxip1 UTSW 8 105841540 missense possibly damaging 0.55
R6406:Tsnaxip1 UTSW 8 105843983 missense probably benign 0.14
R7915:Tsnaxip1 UTSW 8 105842781 missense possibly damaging 0.88
R7918:Tsnaxip1 UTSW 8 105844535 missense probably benign 0.00
R8317:Tsnaxip1 UTSW 8 105827806 missense probably benign 0.07
R8534:Tsnaxip1 UTSW 8 105838738 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGACACTCTGACTAAGCG -3'
(R):5'- ATCCCTCATTCTGAGTGTCAAC -3'

Sequencing Primer
(F):5'- GGACACTCTGACTAAGCGTTCCC -3'
(R):5'- TTAGCAACTCCTTCAGCAGATGGG -3'
Posted On2020-09-02