Incidental Mutation 'R0040:Gprc6a'
ID64676
Institutional Source Beutler Lab
Gene Symbol Gprc6a
Ensembl Gene ENSMUSG00000019905
Gene NameG protein-coupled receptor, family C, group 6, member A
Synonyms
MMRRC Submission 038334-MU
Accession Numbers

Ncbi RefSeq: NM_153071.1; MGI:2429498

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0040 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location51614823-51631461 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 51614984 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 819 (K819*)
Ref Sequence ENSEMBL: ENSMUSP00000151341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020062] [ENSMUST00000218684] [ENSMUST00000219286]
Predicted Effect probably null
Transcript: ENSMUST00000020062
AA Change: K890*
SMART Domains Protein: ENSMUSP00000020062
Gene: ENSMUSG00000019905
AA Change: K890*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 482 2.3e-62 PFAM
Pfam:NCD3G 519 572 5.9e-18 PFAM
Pfam:7tm_3 600 838 2e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000218684
AA Change: K715*
Predicted Effect probably null
Transcript: ENSMUST00000219286
AA Change: K819*
Meta Mutation Damage Score 0.9499 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.6%
Validation Efficiency 100% (88/88)
MGI Phenotype Strain: 3831176
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of family C of the G protein-coupled receptor (GPCR) superfamily, such as GPRC6A, are characterized by an evolutionarily conserved amino acid-sensing motif linked to an intramembranous 7-transmembrane loop region. Several members of GPCR family C, including GPRC6A, also have a long N-terminal domain (summary by Pi et al., 2005 [PubMed 16199532]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show a metabolic syndrome characterized by impaired bone mineralization, increased fat mass, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, testicular feminization and abnormal steroidogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahrr G A 13: 74,283,024 probably benign Het
Antxr2 G A 5: 97,938,425 T441I possibly damaging Het
Apcs A G 1: 172,894,456 Y108H probably benign Het
Atad5 A G 11: 80,098,014 T666A probably benign Het
Atcay C T 10: 81,210,519 probably null Het
Bahcc1 A G 11: 120,268,370 D141G probably damaging Het
Ceacam10 A G 7: 24,778,264 Y68C probably damaging Het
Cfap54 T A 10: 92,977,039 Q1344L probably benign Het
Cyb5r4 A G 9: 87,066,742 probably null Het
Cyp2b9 G T 7: 26,173,474 S14I possibly damaging Het
Dusp12 A G 1: 170,880,657 Y164H probably damaging Het
Eml2 T C 7: 19,196,614 V373A possibly damaging Het
Fat1 A G 8: 45,026,404 D2829G probably damaging Het
Fbxl13 T C 5: 21,486,373 T671A probably damaging Het
Fbxo28 G T 1: 182,326,240 probably benign Het
Fbxo44 A G 4: 148,158,695 L89P probably damaging Het
Fndc3b T A 3: 27,556,117 probably null Het
Gm884 G A 11: 103,542,990 P942S probably damaging Het
Gm9955 G T 18: 24,709,152 probably benign Het
Gxylt1 A T 15: 93,254,555 probably benign Het
Hspa12a T C 19: 58,799,624 T589A probably benign Het
Idh2 A G 7: 80,097,822 S317P probably damaging Het
Ifi30 T C 8: 70,763,776 probably null Het
Ifna16 G A 4: 88,676,630 A76V probably benign Het
Itpr2 C T 6: 146,345,140 E1127K probably damaging Het
Kank4 A G 4: 98,779,220 V330A probably benign Het
Kpna1 T A 16: 36,023,241 D328E probably damaging Het
Krt71 T A 15: 101,738,433 H280L possibly damaging Het
Mapt A G 11: 104,305,398 M446V probably damaging Het
Med1 C T 11: 98,166,255 probably null Het
Mif T A 10: 75,859,780 H63L probably damaging Het
Mycbp2 A G 14: 103,224,272 V1447A probably benign Het
Myo1b A T 1: 51,781,989 I451N probably damaging Het
Nme2 A T 11: 93,951,930 probably null Het
Nubp1 A G 16: 10,421,117 T199A probably damaging Het
Nup210l T A 3: 90,181,905 V1165D probably damaging Het
Nup98 T A 7: 102,192,034 T122S probably damaging Het
Olfr1106 C T 2: 87,049,204 E11K probably damaging Het
Olfr304 A T 7: 86,386,507 L51Q probably benign Het
Olfr354 T C 2: 36,907,458 F171L probably damaging Het
Olfr771 T A 10: 129,160,739 I82L probably benign Het
Pard3b A T 1: 62,637,820 Y1170F probably damaging Het
Pear1 T C 3: 87,754,358 D536G probably damaging Het
Phrf1 G T 7: 141,243,857 R196L probably damaging Het
Plxna2 G T 1: 194,643,896 R46L probably benign Het
Rbm39 G A 2: 156,148,179 T496I possibly damaging Het
Rpl14 C G 9: 120,572,101 F3L possibly damaging Het
Rtf2 G A 2: 172,444,696 S40N probably damaging Het
Runx2 G A 17: 44,608,254 S481L possibly damaging Het
Sh3rf1 T A 8: 61,329,252 Y143N possibly damaging Het
Siglec15 G A 18: 78,048,877 probably benign Het
Slc4a8 T A 15: 100,789,846 I288N probably damaging Het
Ttc38 C A 15: 85,841,489 F184L probably damaging Het
Vmn1r28 T C 6: 58,265,894 Y241H probably damaging Het
Vmn2r110 A T 17: 20,596,084 V59D probably benign Het
Wdpcp A G 11: 21,711,638 I303M probably damaging Het
Zc3h12d G A 10: 7,867,914 A483T probably benign Het
Zfp106 C A 2: 120,531,613 K1008N probably damaging Het
Zfp334 A G 2: 165,381,572 Y184H probably benign Het
Zfp68 G A 5: 138,607,779 T94I probably benign Het
Zkscan3 A T 13: 21,394,920 probably null Het
Other mutations in Gprc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Gprc6a APN 10 51615430 missense probably damaging 1.00
IGL01640:Gprc6a APN 10 51627084 missense probably damaging 0.99
IGL02122:Gprc6a APN 10 51626723 missense probably benign
IGL02317:Gprc6a APN 10 51620953 missense probably benign 0.01
IGL02995:Gprc6a APN 10 51626799 missense probably damaging 1.00
IGL03229:Gprc6a APN 10 51616603 missense probably damaging 1.00
IGL03256:Gprc6a APN 10 51628349 missense possibly damaging 0.77
IGL03290:Gprc6a APN 10 51615872 missense probably damaging 1.00
IGL03393:Gprc6a APN 10 51615259 missense probably damaging 1.00
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R1495:Gprc6a UTSW 10 51628437 missense probably benign 0.01
R1831:Gprc6a UTSW 10 51615806 missense probably benign 0.22
R2108:Gprc6a UTSW 10 51615208 missense probably damaging 1.00
R2159:Gprc6a UTSW 10 51615680 frame shift probably null
R2160:Gprc6a UTSW 10 51615680 frame shift probably null
R2162:Gprc6a UTSW 10 51615680 frame shift probably null
R2229:Gprc6a UTSW 10 51626795 missense possibly damaging 0.50
R3009:Gprc6a UTSW 10 51628296 missense probably benign 0.02
R3709:Gprc6a UTSW 10 51615680 frame shift probably null
R3710:Gprc6a UTSW 10 51615680 frame shift probably null
R3737:Gprc6a UTSW 10 51626911 missense probably benign
R3914:Gprc6a UTSW 10 51628275 missense probably benign 0.00
R3918:Gprc6a UTSW 10 51615680 frame shift probably null
R3964:Gprc6a UTSW 10 51615680 frame shift probably null
R3965:Gprc6a UTSW 10 51615680 frame shift probably null
R3966:Gprc6a UTSW 10 51615680 frame shift probably null
R3973:Gprc6a UTSW 10 51628448 missense possibly damaging 0.93
R3977:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R3978:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R3979:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R4306:Gprc6a UTSW 10 51616639 missense probably damaging 1.00
R4404:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4405:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4408:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4713:Gprc6a UTSW 10 51631457 unclassified probably benign
R4788:Gprc6a UTSW 10 51615008 missense probably benign 0.00
R5248:Gprc6a UTSW 10 51614993 missense probably damaging 1.00
R5263:Gprc6a UTSW 10 51626804 missense probably damaging 1.00
R5436:Gprc6a UTSW 10 51626702 missense probably benign
R5721:Gprc6a UTSW 10 51614980 missense probably benign 0.06
R6061:Gprc6a UTSW 10 51615811 missense probably damaging 1.00
R6092:Gprc6a UTSW 10 51615077 missense probably damaging 1.00
R6132:Gprc6a UTSW 10 51615260 missense possibly damaging 0.89
R6162:Gprc6a UTSW 10 51614912 missense probably benign 0.44
R6207:Gprc6a UTSW 10 51626835 missense probably benign 0.36
R6497:Gprc6a UTSW 10 51615701 missense probably benign 0.05
R6717:Gprc6a UTSW 10 51615137 missense probably damaging 1.00
R6789:Gprc6a UTSW 10 51631316 missense probably damaging 1.00
R6807:Gprc6a UTSW 10 51626745 nonsense probably null
R7000:Gprc6a UTSW 10 51615047 missense probably benign 0.34
R7019:Gprc6a UTSW 10 51631412 missense possibly damaging 0.68
R7143:Gprc6a UTSW 10 51614890 missense probably benign
R7173:Gprc6a UTSW 10 51628499 missense probably benign 0.01
R7579:Gprc6a UTSW 10 51626787 missense probably benign
R7736:Gprc6a UTSW 10 51615453 missense possibly damaging 0.82
R7920:Gprc6a UTSW 10 51614930 missense probably benign 0.02
R8273:Gprc6a UTSW 10 51631274 missense probably benign
R8329:Gprc6a UTSW 10 51627259 nonsense probably null
R8517:Gprc6a UTSW 10 51631241 missense probably benign 0.00
R8723:Gprc6a UTSW 10 51615422 missense probably damaging 1.00
R8815:Gprc6a UTSW 10 51620983 missense probably benign 0.00
Z1177:Gprc6a UTSW 10 51615209 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAAACATCTCACTGGGGATCACAGC -3'
(R):5'- GGCTACATCACAGTTCTGGCCTTC -3'

Sequencing Primer
(F):5'- GGGATCACAGCGTCTCC -3'
(R):5'- GAAGCCAAGTTCCTGACCTTTG -3'
Posted On2013-08-06