Incidental Mutation 'R0040:Gprc6a'
ID 64676
Institutional Source Beutler Lab
Gene Symbol Gprc6a
Ensembl Gene ENSMUSG00000019905
Gene Name G protein-coupled receptor, family C, group 6, member A
Synonyms
MMRRC Submission 038334-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0040 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 51490919-51507554 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 51491080 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 819 (K819*)
Ref Sequence ENSEMBL: ENSMUSP00000151341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020062] [ENSMUST00000218684] [ENSMUST00000219286]
AlphaFold Q8K4Z6
Predicted Effect probably null
Transcript: ENSMUST00000020062
AA Change: K890*
SMART Domains Protein: ENSMUSP00000020062
Gene: ENSMUSG00000019905
AA Change: K890*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 482 2.3e-62 PFAM
Pfam:NCD3G 519 572 5.9e-18 PFAM
Pfam:7tm_3 600 838 2e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000218684
AA Change: K715*
Predicted Effect probably null
Transcript: ENSMUST00000219286
AA Change: K819*
Meta Mutation Damage Score 0.9499 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.6%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of family C of the G protein-coupled receptor (GPCR) superfamily, such as GPRC6A, are characterized by an evolutionarily conserved amino acid-sensing motif linked to an intramembranous 7-transmembrane loop region. Several members of GPCR family C, including GPRC6A, also have a long N-terminal domain (summary by Pi et al., 2005 [PubMed 16199532]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show a metabolic syndrome characterized by impaired bone mineralization, increased fat mass, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, testicular feminization and abnormal steroidogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahrr G A 13: 74,431,143 (GRCm39) probably benign Het
Antxr2 G A 5: 98,086,284 (GRCm39) T441I possibly damaging Het
Apcs A G 1: 172,722,023 (GRCm39) Y108H probably benign Het
Atad5 A G 11: 79,988,840 (GRCm39) T666A probably benign Het
Atcay C T 10: 81,046,353 (GRCm39) probably null Het
Bahcc1 A G 11: 120,159,196 (GRCm39) D141G probably damaging Het
Ceacam10 A G 7: 24,477,689 (GRCm39) Y68C probably damaging Het
Cfap54 T A 10: 92,812,901 (GRCm39) Q1344L probably benign Het
Cyb5r4 A G 9: 86,948,795 (GRCm39) probably null Het
Cyp2b9 G T 7: 25,872,899 (GRCm39) S14I possibly damaging Het
Dusp12 A G 1: 170,708,226 (GRCm39) Y164H probably damaging Het
Eml2 T C 7: 18,930,539 (GRCm39) V373A possibly damaging Het
Fat1 A G 8: 45,479,441 (GRCm39) D2829G probably damaging Het
Fbxl13 T C 5: 21,691,371 (GRCm39) T671A probably damaging Het
Fbxo28 G T 1: 182,153,805 (GRCm39) probably benign Het
Fbxo44 A G 4: 148,243,152 (GRCm39) L89P probably damaging Het
Fndc3b T A 3: 27,610,266 (GRCm39) probably null Het
Gm9955 G T 18: 24,842,209 (GRCm39) probably benign Het
Gxylt1 A T 15: 93,152,436 (GRCm39) probably benign Het
Hspa12a T C 19: 58,788,056 (GRCm39) T589A probably benign Het
Idh2 A G 7: 79,747,570 (GRCm39) S317P probably damaging Het
Ifi30 T C 8: 71,216,421 (GRCm39) probably null Het
Ifna16 G A 4: 88,594,867 (GRCm39) A76V probably benign Het
Itpr2 C T 6: 146,246,638 (GRCm39) E1127K probably damaging Het
Kank4 A G 4: 98,667,457 (GRCm39) V330A probably benign Het
Kpna1 T A 16: 35,843,611 (GRCm39) D328E probably damaging Het
Krt71 T A 15: 101,646,868 (GRCm39) H280L possibly damaging Het
Lrrc37 G A 11: 103,433,816 (GRCm39) P942S probably damaging Het
Mapt A G 11: 104,196,224 (GRCm39) M446V probably damaging Het
Med1 C T 11: 98,057,081 (GRCm39) probably null Het
Mif T A 10: 75,695,614 (GRCm39) H63L probably damaging Het
Mycbp2 A G 14: 103,461,708 (GRCm39) V1447A probably benign Het
Myo1b A T 1: 51,821,148 (GRCm39) I451N probably damaging Het
Nme2 A T 11: 93,842,756 (GRCm39) probably null Het
Nubp1 A G 16: 10,238,981 (GRCm39) T199A probably damaging Het
Nup210l T A 3: 90,089,212 (GRCm39) V1165D probably damaging Het
Nup98 T A 7: 101,841,241 (GRCm39) T122S probably damaging Het
Or14a258 A T 7: 86,035,715 (GRCm39) L51Q probably benign Het
Or1n2 T C 2: 36,797,470 (GRCm39) F171L probably damaging Het
Or5j1 C T 2: 86,879,548 (GRCm39) E11K probably damaging Het
Or6c202 T A 10: 128,996,608 (GRCm39) I82L probably benign Het
Pard3b A T 1: 62,676,979 (GRCm39) Y1170F probably damaging Het
Pear1 T C 3: 87,661,665 (GRCm39) D536G probably damaging Het
Phrf1 G T 7: 140,823,770 (GRCm39) R196L probably damaging Het
Plxna2 G T 1: 194,326,204 (GRCm39) R46L probably benign Het
Rbm39 G A 2: 155,990,099 (GRCm39) T496I possibly damaging Het
Rpl14 C G 9: 120,401,167 (GRCm39) F3L possibly damaging Het
Rtf2 G A 2: 172,286,616 (GRCm39) S40N probably damaging Het
Runx2 G A 17: 44,919,141 (GRCm39) S481L possibly damaging Het
Sh3rf1 T A 8: 61,782,286 (GRCm39) Y143N possibly damaging Het
Siglec15 G A 18: 78,092,092 (GRCm39) probably benign Het
Slc4a8 T A 15: 100,687,727 (GRCm39) I288N probably damaging Het
Ttc38 C A 15: 85,725,690 (GRCm39) F184L probably damaging Het
Vmn1r28 T C 6: 58,242,879 (GRCm39) Y241H probably damaging Het
Vmn2r110 A T 17: 20,816,346 (GRCm39) V59D probably benign Het
Wdpcp A G 11: 21,661,638 (GRCm39) I303M probably damaging Het
Zc3h12d G A 10: 7,743,678 (GRCm39) A483T probably benign Het
Zfp106 C A 2: 120,362,094 (GRCm39) K1008N probably damaging Het
Zfp334 A G 2: 165,223,492 (GRCm39) Y184H probably benign Het
Zfp68 G A 5: 138,606,041 (GRCm39) T94I probably benign Het
Zkscan3 A T 13: 21,579,090 (GRCm39) probably null Het
Other mutations in Gprc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Gprc6a APN 10 51,491,526 (GRCm39) missense probably damaging 1.00
IGL01640:Gprc6a APN 10 51,503,180 (GRCm39) missense probably damaging 0.99
IGL02122:Gprc6a APN 10 51,502,819 (GRCm39) missense probably benign
IGL02317:Gprc6a APN 10 51,497,049 (GRCm39) missense probably benign 0.01
IGL02995:Gprc6a APN 10 51,502,895 (GRCm39) missense probably damaging 1.00
IGL03229:Gprc6a APN 10 51,492,699 (GRCm39) missense probably damaging 1.00
IGL03256:Gprc6a APN 10 51,504,445 (GRCm39) missense possibly damaging 0.77
IGL03290:Gprc6a APN 10 51,491,968 (GRCm39) missense probably damaging 1.00
IGL03393:Gprc6a APN 10 51,491,355 (GRCm39) missense probably damaging 1.00
R0040:Gprc6a UTSW 10 51,491,080 (GRCm39) nonsense probably null
R0050:Gprc6a UTSW 10 51,491,485 (GRCm39) missense probably damaging 1.00
R0050:Gprc6a UTSW 10 51,491,485 (GRCm39) missense probably damaging 1.00
R1495:Gprc6a UTSW 10 51,504,533 (GRCm39) missense probably benign 0.01
R1831:Gprc6a UTSW 10 51,491,902 (GRCm39) missense probably benign 0.22
R2108:Gprc6a UTSW 10 51,491,304 (GRCm39) missense probably damaging 1.00
R2159:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2160:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2162:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2229:Gprc6a UTSW 10 51,502,891 (GRCm39) missense possibly damaging 0.50
R3009:Gprc6a UTSW 10 51,504,392 (GRCm39) missense probably benign 0.02
R3709:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3710:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3737:Gprc6a UTSW 10 51,503,007 (GRCm39) missense probably benign
R3914:Gprc6a UTSW 10 51,504,371 (GRCm39) missense probably benign 0.00
R3918:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3964:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3965:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3966:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3973:Gprc6a UTSW 10 51,504,544 (GRCm39) missense possibly damaging 0.93
R3977:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R3978:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R3979:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R4306:Gprc6a UTSW 10 51,492,735 (GRCm39) missense probably damaging 1.00
R4404:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4405:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4408:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4713:Gprc6a UTSW 10 51,507,553 (GRCm39) unclassified probably benign
R4788:Gprc6a UTSW 10 51,491,104 (GRCm39) missense probably benign 0.00
R5248:Gprc6a UTSW 10 51,491,089 (GRCm39) missense probably damaging 1.00
R5263:Gprc6a UTSW 10 51,502,900 (GRCm39) missense probably damaging 1.00
R5436:Gprc6a UTSW 10 51,502,798 (GRCm39) missense probably benign
R5721:Gprc6a UTSW 10 51,491,076 (GRCm39) missense probably benign 0.06
R6061:Gprc6a UTSW 10 51,491,907 (GRCm39) missense probably damaging 1.00
R6092:Gprc6a UTSW 10 51,491,173 (GRCm39) missense probably damaging 1.00
R6132:Gprc6a UTSW 10 51,491,356 (GRCm39) missense possibly damaging 0.89
R6162:Gprc6a UTSW 10 51,491,008 (GRCm39) missense probably benign 0.44
R6207:Gprc6a UTSW 10 51,502,931 (GRCm39) missense probably benign 0.36
R6497:Gprc6a UTSW 10 51,491,797 (GRCm39) missense probably benign 0.05
R6717:Gprc6a UTSW 10 51,491,233 (GRCm39) missense probably damaging 1.00
R6789:Gprc6a UTSW 10 51,507,412 (GRCm39) missense probably damaging 1.00
R6807:Gprc6a UTSW 10 51,502,841 (GRCm39) nonsense probably null
R7000:Gprc6a UTSW 10 51,491,143 (GRCm39) missense probably benign 0.34
R7019:Gprc6a UTSW 10 51,507,508 (GRCm39) missense possibly damaging 0.68
R7143:Gprc6a UTSW 10 51,490,986 (GRCm39) missense probably benign
R7173:Gprc6a UTSW 10 51,504,595 (GRCm39) missense probably benign 0.01
R7579:Gprc6a UTSW 10 51,502,883 (GRCm39) missense probably benign
R7736:Gprc6a UTSW 10 51,491,549 (GRCm39) missense possibly damaging 0.82
R7920:Gprc6a UTSW 10 51,491,026 (GRCm39) missense probably benign 0.02
R8273:Gprc6a UTSW 10 51,507,370 (GRCm39) missense probably benign
R8329:Gprc6a UTSW 10 51,503,355 (GRCm39) nonsense probably null
R8517:Gprc6a UTSW 10 51,507,337 (GRCm39) missense probably benign 0.00
R8723:Gprc6a UTSW 10 51,491,518 (GRCm39) missense probably damaging 1.00
R8815:Gprc6a UTSW 10 51,497,079 (GRCm39) missense probably benign 0.00
R8829:Gprc6a UTSW 10 51,491,295 (GRCm39) missense probably damaging 0.99
R9151:Gprc6a UTSW 10 51,497,182 (GRCm39) missense possibly damaging 0.94
R9420:Gprc6a UTSW 10 51,491,506 (GRCm39) missense probably damaging 0.99
R9753:Gprc6a UTSW 10 51,504,364 (GRCm39) missense probably benign 0.20
R9766:Gprc6a UTSW 10 51,491,884 (GRCm39) missense probably damaging 1.00
R9790:Gprc6a UTSW 10 51,491,395 (GRCm39) missense probably damaging 0.98
R9791:Gprc6a UTSW 10 51,491,395 (GRCm39) missense probably damaging 0.98
Z1177:Gprc6a UTSW 10 51,491,305 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAAACATCTCACTGGGGATCACAGC -3'
(R):5'- GGCTACATCACAGTTCTGGCCTTC -3'

Sequencing Primer
(F):5'- GGGATCACAGCGTCTCC -3'
(R):5'- GAAGCCAAGTTCCTGACCTTTG -3'
Posted On 2013-08-06