Incidental Mutation 'R8377:Dsg1a'
ID646781
Institutional Source Beutler Lab
Gene Symbol Dsg1a
Ensembl Gene ENSMUSG00000069441
Gene Namedesmoglein 1 alpha
SynonymsDsg1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R8377 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location20310811-20343350 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20333774 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 567 (I567N)
Ref Sequence ENSEMBL: ENSMUSP00000076393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077146]
Predicted Effect probably damaging
Transcript: ENSMUST00000077146
AA Change: I567N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076393
Gene: ENSMUSG00000069441
AA Change: I567N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 3.45e-14 SMART
CA 179 267 3.11e-21 SMART
CA 290 384 6.29e-8 SMART
CA 407 485 6.44e-1 SMART
low complexity region 573 584 N/A INTRINSIC
low complexity region 590 598 N/A INTRINSIC
Pfam:Cadherin_C 659 781 1.6e-10 PFAM
low complexity region 786 799 N/A INTRINSIC
internal_repeat_1 823 888 9.56e-6 PROSPERO
internal_repeat_1 908 975 9.56e-6 PROSPERO
low complexity region 983 1004 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
Acot3 C A 12: 84,058,787 C251* probably null Het
Acsbg1 A G 9: 54,622,505 C273R probably damaging Het
Adh6a A G 3: 138,326,123 T259A probably damaging Het
Aknad1 A G 3: 108,781,939 H639R possibly damaging Het
Alkal2 G T 12: 30,884,851 G23V probably damaging Het
Ampd3 A G 7: 110,800,730 R342G probably damaging Het
Arid5b G T 10: 68,097,387 A895E probably damaging Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Bmp8a G T 4: 123,342,689 P7Q unknown Het
Boll A C 1: 55,323,678 V187G possibly damaging Het
Ccdc162 A T 10: 41,581,310 C1544S probably benign Het
Cmss1 A C 16: 57,307,394 M182R possibly damaging Het
Cntn3 T C 6: 102,209,293 M578V probably benign Het
Dmxl2 A T 9: 54,378,748 W2718R probably damaging Het
Epc2 T A 2: 49,522,515 D168E probably damaging Het
Ern2 G A 7: 122,181,292 Q162* probably null Het
F11r G T 1: 171,437,543 probably benign Het
Fam196b C A 11: 34,401,964 A2D probably damaging Het
Fcgrt T C 7: 45,102,563 Y59C probably damaging Het
Fmn2 G T 1: 174,608,445 E661* probably null Het
Gbp4 T A 5: 105,118,462 Q571L probably benign Het
Gm29106 A T 1: 118,198,863 H95L probably damaging Het
Gphn G A 12: 78,664,506 V621M probably damaging Het
Grwd1 T C 7: 45,830,612 Y57C probably damaging Het
Irs2 G A 8: 11,004,848 Q1195* probably null Het
Itpr1 G C 6: 108,510,738 C2375S probably benign Het
Kcnmb4 A T 10: 116,446,385 Y136N probably benign Het
Matn2 C T 15: 34,345,365 P173S probably damaging Het
Med17 A C 9: 15,262,359 D606E probably damaging Het
Mpl A G 4: 118,444,057 V537A Het
Mrpl1 C G 5: 96,226,367 A167G probably benign Het
Mrpl21 T C 19: 3,292,487 F206S unknown Het
Msh6 T A 17: 87,985,170 M451K probably damaging Het
Myo10 T C 15: 25,804,395 I1592T possibly damaging Het
Naip1 A T 13: 100,425,866 D930E possibly damaging Het
Necap2 T C 4: 141,068,223 I242V probably benign Het
Nfya A G 17: 48,392,045 V240A possibly damaging Het
Olfml2b A G 1: 170,668,784 D328G probably damaging Het
Olfr1277 T A 2: 111,269,638 H243L probably damaging Het
Olfr1337 A T 4: 118,782,006 M193K probably benign Het
Olfr1449 T G 19: 12,935,035 V99G probably benign Het
Olfr473 T G 7: 107,933,685 L55R probably damaging Het
Pkd1l3 T C 8: 109,635,350 V1018A probably benign Het
Plcg1 T C 2: 160,754,922 L761P probably damaging Het
Ppp1r36 T C 12: 76,438,441 S313P possibly damaging Het
Ptpru C A 4: 131,808,335 G444C probably damaging Het
Rfxank A T 8: 70,135,310 V149D probably damaging Het
Rimbp2 G A 5: 128,780,331 H819Y probably damaging Het
Sgms1 T C 19: 32,124,421 Y395C probably damaging Het
Siae G A 9: 37,631,605 probably null Het
Slc46a2 T A 4: 59,914,713 D70V probably damaging Het
Smpdl3a A C 10: 57,800,936 L43F possibly damaging Het
Spcs1 T A 14: 31,000,146 D146V possibly damaging Het
Srcin1 T C 11: 97,551,978 D8G probably damaging Het
Stra6 G T 9: 58,149,205 L373F probably damaging Het
Tacc1 A T 8: 25,182,283 S310T possibly damaging Het
Tlr12 T C 4: 128,615,773 S895G probably benign Het
Tnfaip3 A G 10: 19,011,510 V89A probably damaging Het
Top1 C T 2: 160,646,089 probably benign Het
Trappc13 T G 13: 104,161,001 I132L probably benign Het
Trpt1 C T 19: 6,998,981 Q249* probably null Het
Tsnaxip1 A C 8: 105,842,547 K510Q probably damaging Het
Usp39 A T 6: 72,328,674 N375K probably benign Het
Vldlr T A 19: 27,234,858 C91S probably damaging Het
Vmn1r232 T A 17: 20,913,977 L120F probably benign Het
Vmn2r71 T C 7: 85,615,499 V13A probably benign Het
Wdr11 T A 7: 129,606,688 V389E possibly damaging Het
Wsb2 A T 5: 117,376,701 I321F possibly damaging Het
Zan A T 5: 137,391,687 V4841E unknown Het
Zfy1 A T Y: 725,723 F681I possibly damaging Het
Zpld1 C A 16: 55,246,654 E179D probably benign Het
Other mutations in Dsg1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Dsg1a APN 18 20340206 missense probably damaging 1.00
IGL01148:Dsg1a APN 18 20320925 missense probably damaging 0.97
IGL01534:Dsg1a APN 18 20340996 missense probably benign 0.06
IGL01566:Dsg1a APN 18 20336783 splice site probably benign
IGL01582:Dsg1a APN 18 20328848 missense probably null 1.00
IGL01913:Dsg1a APN 18 20322236 missense probably damaging 1.00
IGL01926:Dsg1a APN 18 20333584 missense possibly damaging 0.60
IGL02102:Dsg1a APN 18 20332032 missense probably benign 0.01
IGL02900:Dsg1a APN 18 20328656 splice site probably benign
IGL02937:Dsg1a APN 18 20331534 missense possibly damaging 0.93
IGL02962:Dsg1a APN 18 20340324 missense possibly damaging 0.92
IGL03003:Dsg1a APN 18 20336819 missense probably benign 0.43
PIT4687001:Dsg1a UTSW 18 20331698 missense probably benign 0.16
R0126:Dsg1a UTSW 18 20340878 missense probably benign 0.00
R0200:Dsg1a UTSW 18 20340938 missense probably benign 0.00
R0284:Dsg1a UTSW 18 20331627 missense probably damaging 0.98
R0394:Dsg1a UTSW 18 20333750 missense probably damaging 1.00
R0543:Dsg1a UTSW 18 20340863 missense probably damaging 1.00
R0656:Dsg1a UTSW 18 20335892 splice site probably benign
R0733:Dsg1a UTSW 18 20338668 missense probably damaging 0.97
R0750:Dsg1a UTSW 18 20340153 missense probably benign 0.10
R1300:Dsg1a UTSW 18 20332149 missense probably benign 0.19
R1501:Dsg1a UTSW 18 20332019 missense probably damaging 1.00
R1523:Dsg1a UTSW 18 20322317 missense probably damaging 0.99
R1673:Dsg1a UTSW 18 20331504 missense probably damaging 1.00
R1980:Dsg1a UTSW 18 20338650 missense probably damaging 1.00
R2102:Dsg1a UTSW 18 20333773 missense probably damaging 1.00
R2132:Dsg1a UTSW 18 20340797 missense probably damaging 1.00
R2299:Dsg1a UTSW 18 20340150 missense probably damaging 1.00
R2426:Dsg1a UTSW 18 20336804 missense probably damaging 0.96
R3031:Dsg1a UTSW 18 20340492 missense probably damaging 1.00
R4044:Dsg1a UTSW 18 20324030 missense probably damaging 1.00
R4075:Dsg1a UTSW 18 20340070 missense possibly damaging 0.53
R4644:Dsg1a UTSW 18 20340728 missense probably benign 0.04
R4661:Dsg1a UTSW 18 20340533 missense probably damaging 0.99
R4816:Dsg1a UTSW 18 20333722 missense probably benign 0.10
R5221:Dsg1a UTSW 18 20324014 missense possibly damaging 0.64
R5257:Dsg1a UTSW 18 20320931 missense probably damaging 1.00
R5360:Dsg1a UTSW 18 20340954 missense probably damaging 0.96
R5547:Dsg1a UTSW 18 20336040 critical splice donor site probably null
R5702:Dsg1a UTSW 18 20336865 critical splice donor site probably null
R5987:Dsg1a UTSW 18 20331542 missense probably damaging 1.00
R6108:Dsg1a UTSW 18 20340247 missense probably benign 0.19
R6170:Dsg1a UTSW 18 20335986 missense probably damaging 0.99
R7018:Dsg1a UTSW 18 20328738 missense possibly damaging 0.48
R7201:Dsg1a UTSW 18 20328311 missense probably damaging 0.98
R7730:Dsg1a UTSW 18 20331711 missense possibly damaging 0.77
R7814:Dsg1a UTSW 18 20338515 splice site probably null
R8185:Dsg1a UTSW 18 20340612 missense probably damaging 1.00
R8297:Dsg1a UTSW 18 20332033 missense probably benign 0.02
R8409:Dsg1a UTSW 18 20340151 missense probably damaging 1.00
R8775:Dsg1a UTSW 18 20340507 missense probably damaging 0.98
R8775-TAIL:Dsg1a UTSW 18 20340507 missense probably damaging 0.98
R8818:Dsg1a UTSW 18 20340542 missense possibly damaging 0.87
R8821:Dsg1a UTSW 18 20320308 missense probably damaging 0.96
R8831:Dsg1a UTSW 18 20320308 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACCGAGTGACTAATGGATATCAAGG -3'
(R):5'- TAGCCTTCACCTATGGGACC -3'

Sequencing Primer
(F):5'- GGCACTTCTTCCACTGAGAAC -3'
(R):5'- ATGGGACCTCTCCTCATCTAGAG -3'
Posted On2020-09-02