Incidental Mutation 'R8377:Vldlr'
ID646785
Institutional Source Beutler Lab
Gene Symbol Vldlr
Ensembl Gene ENSMUSG00000024924
Gene Namevery low density lipoprotein receptor
SynonymsAA408956, AI451093, AW047288, VLDL receptor
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.327) question?
Stock #R8377 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location27216484-27254231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 27234858 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 91 (C91S)
Ref Sequence ENSEMBL: ENSMUSP00000127329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025866] [ENSMUST00000047645] [ENSMUST00000164746] [ENSMUST00000165761] [ENSMUST00000167487] [ENSMUST00000172302]
Predicted Effect probably damaging
Transcript: ENSMUST00000025866
AA Change: C91S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025866
Gene: ENSMUSG00000024924
AA Change: C91S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 5.81e-15 SMART
LDLa 112 151 1.96e-12 SMART
LDLa 153 190 7.15e-15 SMART
LDLa 192 231 1.23e-13 SMART
LDLa 238 275 1.1e-15 SMART
LDLa 277 314 1.13e-12 SMART
LDLa 317 357 3.86e-11 SMART
EGF_CA 356 395 1e-5 SMART
EGF_CA 396 435 6.1e-10 SMART
Blast:LY 461 495 4e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000047645
AA Change: C91S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049145
Gene: ENSMUSG00000024924
AA Change: C91S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 1.25e-14 SMART
LDLa 112 149 7.15e-15 SMART
LDLa 151 190 1.23e-13 SMART
LDLa 197 234 1.1e-15 SMART
LDLa 236 273 1.13e-12 SMART
LDLa 276 316 3.86e-11 SMART
EGF_CA 315 354 1e-5 SMART
EGF_CA 355 394 6.1e-10 SMART
LY 420 462 2.16e-1 SMART
LY 464 506 9.54e-12 SMART
LY 507 550 2.22e-12 SMART
LY 551 593 1.66e-11 SMART
LY 594 637 5.97e-4 SMART
EGF 664 709 2.16e-1 SMART
transmembrane domain 728 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164746
SMART Domains Protein: ENSMUSP00000128193
Gene: ENSMUSG00000024924

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LDLa 32 69 1.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165761
SMART Domains Protein: ENSMUSP00000130382
Gene: ENSMUSG00000024924

DomainStartEndE-ValueType
LDLa 1 26 1.58e0 SMART
EGF 28 64 4e-5 SMART
LY 88 130 2.16e-1 SMART
LY 132 174 9.54e-12 SMART
LY 175 218 2.22e-12 SMART
LY 219 258 3.25e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167487
AA Change: C91S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127329
Gene: ENSMUSG00000024924
AA Change: C91S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 5.81e-15 SMART
LDLa 112 151 1.96e-12 SMART
LDLa 153 190 7.15e-15 SMART
LDLa 192 231 1.23e-13 SMART
LDLa 238 275 1.1e-15 SMART
LDLa 277 314 1.13e-12 SMART
LDLa 317 357 3.86e-11 SMART
EGF_CA 356 395 1e-5 SMART
EGF_CA 396 435 6.1e-10 SMART
LY 461 503 2.16e-1 SMART
LY 505 547 9.54e-12 SMART
LY 548 591 2.22e-12 SMART
LY 592 634 1.66e-11 SMART
LY 635 678 5.97e-4 SMART
EGF 705 750 2.16e-1 SMART
transmembrane domain 797 819 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172302
AA Change: C91S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126730
Gene: ENSMUSG00000024924
AA Change: C91S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 5.81e-15 SMART
LDLa 112 151 1.96e-12 SMART
LDLa 153 190 7.15e-15 SMART
LDLa 192 231 1.23e-13 SMART
LDLa 238 275 1.1e-15 SMART
LDLa 277 314 1.13e-12 SMART
LDLa 317 357 3.86e-11 SMART
EGF_CA 356 395 1e-5 SMART
EGF_CA 396 435 6.1e-10 SMART
LY 461 503 2.16e-1 SMART
LY 505 547 9.54e-12 SMART
LY 548 591 2.22e-12 SMART
LY 592 634 1.66e-11 SMART
LY 635 678 5.97e-4 SMART
EGF 705 750 2.16e-1 SMART
transmembrane domain 769 791 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. This gene encodes a lipoprotein receptor that is a member of the LDLR family and plays important roles in VLDL-triglyceride metabolism and the reelin signaling pathway. Mutations in this gene cause VLDLR-associated cerebellar hypoplasia. Alternative splicing generates multiple transcript variants encoding distinct isoforms for this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygous null mutants exhibit modest reductions in body weight and adiposity. In behavioral tests, mutants display deficits in contextual fear conditioning and long term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
Acot3 C A 12: 84,058,787 C251* probably null Het
Acsbg1 A G 9: 54,622,505 C273R probably damaging Het
Adh6a A G 3: 138,326,123 T259A probably damaging Het
Aknad1 A G 3: 108,781,939 H639R possibly damaging Het
Alkal2 G T 12: 30,884,851 G23V probably damaging Het
Ampd3 A G 7: 110,800,730 R342G probably damaging Het
Arid5b G T 10: 68,097,387 A895E probably damaging Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Bmp8a G T 4: 123,342,689 P7Q unknown Het
Boll A C 1: 55,323,678 V187G possibly damaging Het
Ccdc162 A T 10: 41,581,310 C1544S probably benign Het
Cmss1 A C 16: 57,307,394 M182R possibly damaging Het
Cntn3 T C 6: 102,209,293 M578V probably benign Het
Dmxl2 A T 9: 54,378,748 W2718R probably damaging Het
Dsg1a T A 18: 20,333,774 I567N probably damaging Het
Epc2 T A 2: 49,522,515 D168E probably damaging Het
Ern2 G A 7: 122,181,292 Q162* probably null Het
F11r G T 1: 171,437,543 probably benign Het
Fam196b C A 11: 34,401,964 A2D probably damaging Het
Fcgrt T C 7: 45,102,563 Y59C probably damaging Het
Fmn2 G T 1: 174,608,445 E661* probably null Het
Gbp4 T A 5: 105,118,462 Q571L probably benign Het
Gm29106 A T 1: 118,198,863 H95L probably damaging Het
Gphn G A 12: 78,664,506 V621M probably damaging Het
Grwd1 T C 7: 45,830,612 Y57C probably damaging Het
Irs2 G A 8: 11,004,848 Q1195* probably null Het
Itpr1 G C 6: 108,510,738 C2375S probably benign Het
Kcnmb4 A T 10: 116,446,385 Y136N probably benign Het
Matn2 C T 15: 34,345,365 P173S probably damaging Het
Med17 A C 9: 15,262,359 D606E probably damaging Het
Mpl A G 4: 118,444,057 V537A Het
Mrpl1 C G 5: 96,226,367 A167G probably benign Het
Mrpl21 T C 19: 3,292,487 F206S unknown Het
Msh6 T A 17: 87,985,170 M451K probably damaging Het
Myo10 T C 15: 25,804,395 I1592T possibly damaging Het
Naip1 A T 13: 100,425,866 D930E possibly damaging Het
Necap2 T C 4: 141,068,223 I242V probably benign Het
Nfya A G 17: 48,392,045 V240A possibly damaging Het
Olfml2b A G 1: 170,668,784 D328G probably damaging Het
Olfr1277 T A 2: 111,269,638 H243L probably damaging Het
Olfr1337 A T 4: 118,782,006 M193K probably benign Het
Olfr1449 T G 19: 12,935,035 V99G probably benign Het
Olfr473 T G 7: 107,933,685 L55R probably damaging Het
Pkd1l3 T C 8: 109,635,350 V1018A probably benign Het
Plcg1 T C 2: 160,754,922 L761P probably damaging Het
Ppp1r36 T C 12: 76,438,441 S313P possibly damaging Het
Ptpru C A 4: 131,808,335 G444C probably damaging Het
Rfxank A T 8: 70,135,310 V149D probably damaging Het
Rimbp2 G A 5: 128,780,331 H819Y probably damaging Het
Sgms1 T C 19: 32,124,421 Y395C probably damaging Het
Siae G A 9: 37,631,605 probably null Het
Slc46a2 T A 4: 59,914,713 D70V probably damaging Het
Smpdl3a A C 10: 57,800,936 L43F possibly damaging Het
Spcs1 T A 14: 31,000,146 D146V possibly damaging Het
Srcin1 T C 11: 97,551,978 D8G probably damaging Het
Stra6 G T 9: 58,149,205 L373F probably damaging Het
Tacc1 A T 8: 25,182,283 S310T possibly damaging Het
Tlr12 T C 4: 128,615,773 S895G probably benign Het
Tnfaip3 A G 10: 19,011,510 V89A probably damaging Het
Top1 C T 2: 160,646,089 probably benign Het
Trappc13 T G 13: 104,161,001 I132L probably benign Het
Trpt1 C T 19: 6,998,981 Q249* probably null Het
Tsnaxip1 A C 8: 105,842,547 K510Q probably damaging Het
Usp39 A T 6: 72,328,674 N375K probably benign Het
Vmn1r232 T A 17: 20,913,977 L120F probably benign Het
Vmn2r71 T C 7: 85,615,499 V13A probably benign Het
Wdr11 T A 7: 129,606,688 V389E possibly damaging Het
Wsb2 A T 5: 117,376,701 I321F possibly damaging Het
Zan A T 5: 137,391,687 V4841E unknown Het
Zfy1 A T Y: 725,723 F681I possibly damaging Het
Zpld1 C A 16: 55,246,654 E179D probably benign Het
Other mutations in Vldlr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Vldlr APN 19 27239681 missense possibly damaging 0.93
IGL01575:Vldlr APN 19 27246631 missense probably benign
IGL01626:Vldlr APN 19 27243773 missense probably damaging 1.00
IGL02213:Vldlr APN 19 27241326 missense probably benign 0.09
IGL02365:Vldlr APN 19 27245625 missense probably damaging 1.00
IGL02488:Vldlr APN 19 27238275 missense probably damaging 1.00
IGL02708:Vldlr APN 19 27238085 missense possibly damaging 0.92
IGL02947:Vldlr APN 19 27239720 missense probably benign 0.03
disturbed UTSW 19 27238804 nonsense probably null
r26 UTSW 19 27245654 missense probably damaging 0.99
spotty UTSW 19 27238792 missense probably damaging 1.00
PIT4142001:Vldlr UTSW 19 27234869 missense probably benign 0.05
R0195:Vldlr UTSW 19 27238386 missense probably damaging 1.00
R0288:Vldlr UTSW 19 27240651 splice site probably benign
R0536:Vldlr UTSW 19 27239964 missense probably damaging 1.00
R0537:Vldlr UTSW 19 27247918 missense probably damaging 1.00
R0542:Vldlr UTSW 19 27236255 missense probably benign 0.01
R0594:Vldlr UTSW 19 27234819 missense probably damaging 1.00
R0624:Vldlr UTSW 19 27238263 missense possibly damaging 0.91
R0726:Vldlr UTSW 19 27238386 missense probably damaging 1.00
R1017:Vldlr UTSW 19 27241333 missense probably damaging 1.00
R1148:Vldlr UTSW 19 27241291 missense probably benign 0.01
R1148:Vldlr UTSW 19 27241291 missense probably benign 0.01
R1443:Vldlr UTSW 19 27239721 missense possibly damaging 0.91
R1493:Vldlr UTSW 19 27241291 missense probably benign 0.01
R1520:Vldlr UTSW 19 27240543 missense probably damaging 0.99
R1520:Vldlr UTSW 19 27247066 missense possibly damaging 0.96
R1657:Vldlr UTSW 19 27245670 missense probably benign 0.00
R1901:Vldlr UTSW 19 27241309 missense probably damaging 1.00
R2047:Vldlr UTSW 19 27234838 missense probably damaging 1.00
R2258:Vldlr UTSW 19 27238386 missense probably damaging 1.00
R2273:Vldlr UTSW 19 27248015 missense probably damaging 1.00
R2423:Vldlr UTSW 19 27236288 missense possibly damaging 0.49
R3196:Vldlr UTSW 19 27243154 missense probably damaging 0.98
R3752:Vldlr UTSW 19 27238331 missense probably damaging 1.00
R3801:Vldlr UTSW 19 27217621 missense probably damaging 0.99
R3835:Vldlr UTSW 19 27234814 missense probably damaging 1.00
R4027:Vldlr UTSW 19 27238313 missense probably benign
R4301:Vldlr UTSW 19 27238402 missense possibly damaging 0.80
R4470:Vldlr UTSW 19 27234819 missense probably damaging 0.96
R4541:Vldlr UTSW 19 27238792 missense probably damaging 1.00
R4765:Vldlr UTSW 19 27240547 missense probably damaging 1.00
R4771:Vldlr UTSW 19 27239890 missense probably damaging 0.97
R4795:Vldlr UTSW 19 27238852 splice site probably null
R4839:Vldlr UTSW 19 27238065 missense probably damaging 1.00
R5074:Vldlr UTSW 19 27238277 missense probably damaging 1.00
R5134:Vldlr UTSW 19 27238812 nonsense probably null
R5281:Vldlr UTSW 19 27244231 missense probably benign 0.44
R5466:Vldlr UTSW 19 27239843 critical splice acceptor site probably null
R5514:Vldlr UTSW 19 27244224 missense probably damaging 0.97
R5886:Vldlr UTSW 19 27243771 missense probably benign 0.03
R5889:Vldlr UTSW 19 27239664 missense probably damaging 1.00
R6110:Vldlr UTSW 19 27238077 missense possibly damaging 0.92
R6343:Vldlr UTSW 19 27245649 missense probably damaging 0.99
R6833:Vldlr UTSW 19 27240574 missense probably damaging 1.00
R6838:Vldlr UTSW 19 27247970 missense probably damaging 1.00
R7169:Vldlr UTSW 19 27244328 missense probably benign
R7197:Vldlr UTSW 19 27234841 missense probably benign 0.36
R7304:Vldlr UTSW 19 27238604 missense possibly damaging 0.93
R7403:Vldlr UTSW 19 27236274 nonsense probably null
R7658:Vldlr UTSW 19 27243136 missense probably benign 0.33
R7754:Vldlr UTSW 19 27217615 start codon destroyed probably benign 0.01
R8105:Vldlr UTSW 19 27238804 nonsense probably null
R8529:Vldlr UTSW 19 27230256 missense probably benign 0.03
R8777:Vldlr UTSW 19 27240546 missense probably benign 0.00
R8777-TAIL:Vldlr UTSW 19 27240546 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGAGCTCAGCCCTAGAGATGC -3'
(R):5'- TCAAGTTTCAGGCAGGCAAAG -3'

Sequencing Primer
(F):5'- GCCCTAGAGATGCCAACAATTTG -3'
(R):5'- TTTCAGGCAGGCAAAGAAAAATG -3'
Posted On2020-09-02