Incidental Mutation 'R8378:Rfx8'
ID646788
Institutional Source Beutler Lab
Gene Symbol Rfx8
Ensembl Gene ENSMUSG00000057173
Gene Nameregulatory factor X 8
Synonyms4933400N17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8378 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location39665301-39720997 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39670421 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 482 (D482V)
Ref Sequence ENSEMBL: ENSMUSP00000121212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151913]
Predicted Effect probably damaging
Transcript: ENSMUST00000151913
AA Change: D482V

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121212
Gene: ENSMUSG00000057173
AA Change: D482V

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 17 94 6.5e-31 PFAM
Blast:DEXDc 301 358 4e-8 BLAST
low complexity region 445 467 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
4933412E24Rik A G 15: 60,015,118 I491T probably damaging Het
Alkal2 G T 12: 30,884,851 G23V probably damaging Het
Ankrd40 G T 11: 94,334,836 G231V probably damaging Het
Ap1s3 T C 1: 79,623,728 E82G probably damaging Het
Bmp3 A G 5: 98,855,389 N93D probably damaging Het
Car9 C T 4: 43,509,021 R224C probably damaging Het
Cass4 T C 2: 172,427,794 C599R probably benign Het
Ccdc171 A G 4: 83,864,253 N1261D possibly damaging Het
Cdc42bpa A G 1: 180,162,144 D1726G probably damaging Het
Ceacam2 G A 7: 25,518,172 A306V probably damaging Het
Crebrf G T 17: 26,762,289 L546F probably damaging Het
Crhr2 A G 6: 55,092,956 F370S probably damaging Het
Dhtkd1 T C 2: 5,917,888 T487A probably benign Het
Diaph1 G A 18: 37,891,953 A485V unknown Het
Dmbt1 T C 7: 131,106,465 V1479A probably damaging Het
Efemp1 C T 11: 28,921,765 R427W probably damaging Het
Gm11444 C A 11: 85,850,249 W28L Het
Gm436 C G 4: 144,670,599 V188L probably benign Het
Golga4 A G 9: 118,558,322 D1504G probably benign Het
Hirip3 A G 7: 126,863,585 S238G probably benign Het
Igkv1-135 T A 6: 67,610,394 V83D possibly damaging Het
Ippk T A 13: 49,435,579 C183* probably null Het
Itgb3 A G 11: 104,642,316 T419A possibly damaging Het
Kcnt1 A G 2: 25,907,271 H129R probably benign Het
Kif18b A T 11: 102,916,473 V12E probably damaging Het
Kif2b C A 11: 91,576,375 G361C possibly damaging Het
Klhl30 A T 1: 91,357,772 K339* probably null Het
Lrfn1 A G 7: 28,459,732 I359V probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ndufaf2 C A 13: 108,052,853 L120F probably damaging Het
Nlrp1b A G 11: 71,161,719 V961A possibly damaging Het
Olfr1145 T A 2: 87,810,050 Y77N probably damaging Het
Olfr132 A G 17: 38,130,787 V135A probably benign Het
Pcnx2 G A 8: 125,760,910 P1785S probably damaging Het
Pcyt2 A G 11: 120,613,408 Y170H probably benign Het
Rilpl1 T C 5: 124,530,901 Y28C probably damaging Het
Sgce G C 6: 4,689,760 L394V probably damaging Het
Sgce T A 6: 4,691,525 Y350F probably benign Het
Tbk1 A G 10: 121,578,692 V39A probably damaging Het
Tns1 T A 1: 73,937,246 I1148F probably damaging Het
Vmn1r192 T A 13: 22,187,859 R64* probably null Het
Vmn2r68 A T 7: 85,221,900 V725E probably benign Het
Yy1 A T 12: 108,793,636 H75L unknown Het
Zwilch A T 9: 64,152,958 V366D possibly damaging Het
Other mutations in Rfx8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Rfx8 APN 1 39682950 nonsense probably null
IGL01659:Rfx8 APN 1 39670573 missense probably damaging 1.00
IGL02239:Rfx8 APN 1 39680886 missense probably benign 0.00
IGL02302:Rfx8 APN 1 39665522 missense possibly damaging 0.50
IGL02332:Rfx8 APN 1 39718480 missense possibly damaging 0.89
IGL02598:Rfx8 APN 1 39695968 splice site probably benign
IGL02870:Rfx8 APN 1 39683711 missense possibly damaging 0.94
IGL03403:Rfx8 APN 1 39690173 missense possibly damaging 0.94
PIT4515001:Rfx8 UTSW 1 39690105 missense probably benign 0.04
R0060:Rfx8 UTSW 1 39718405 splice site probably benign
R0095:Rfx8 UTSW 1 39685536 missense possibly damaging 0.58
R0265:Rfx8 UTSW 1 39688577 missense possibly damaging 0.67
R1892:Rfx8 UTSW 1 39670586 splice site probably null
R2054:Rfx8 UTSW 1 39685559 missense possibly damaging 0.92
R2960:Rfx8 UTSW 1 39682952 missense probably damaging 1.00
R4554:Rfx8 UTSW 1 39680940 missense probably benign 0.00
R5410:Rfx8 UTSW 1 39710156 critical splice donor site probably null
R5496:Rfx8 UTSW 1 39670347 missense probably benign 0.01
R5502:Rfx8 UTSW 1 39682953 missense probably damaging 1.00
R5916:Rfx8 UTSW 1 39688619 missense probably benign 0.20
R6238:Rfx8 UTSW 1 39670394 missense probably damaging 0.96
R6360:Rfx8 UTSW 1 39680965 missense probably benign
R7593:Rfx8 UTSW 1 39683678 missense probably damaging 1.00
R7738:Rfx8 UTSW 1 39682931 missense probably damaging 1.00
R8753:Rfx8 UTSW 1 39718440 missense probably damaging 1.00
T0722:Rfx8 UTSW 1 39683612 missense probably damaging 1.00
Z1088:Rfx8 UTSW 1 39682966 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ACTCTTCAGGCCATGCATGC -3'
(R):5'- AAATGTAGGTGCCTGGCATC -3'

Sequencing Primer
(F):5'- ATTAATTCTCTCCCTCTGTGTGTATG -3'
(R):5'- GGTGCCTGGCATCTGTTTCATC -3'
Posted On2020-09-02