Incidental Mutation 'R8378:Lrfn1'
ID646807
Institutional Source Beutler Lab
Gene Symbol Lrfn1
Ensembl Gene ENSMUSG00000030600
Gene Nameleucine rich repeat and fibronectin type III domain containing 1
SynonymsSALM2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.604) question?
Stock #R8378 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location28451980-28468242 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28459732 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 359 (I359V)
Ref Sequence ENSEMBL: ENSMUSP00000103923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040531] [ENSMUST00000055110] [ENSMUST00000108288] [ENSMUST00000189877] [ENSMUST00000190954]
Predicted Effect probably benign
Transcript: ENSMUST00000040531
SMART Domains Protein: ENSMUSP00000040486
Gene: ENSMUSG00000109336

DomainStartEndE-ValueType
low complexity region 81 90 N/A INTRINSIC
low complexity region 174 190 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 278 290 N/A INTRINSIC
SAM 296 359 1.02e-9 SMART
low complexity region 406 420 N/A INTRINSIC
low complexity region 433 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055110
AA Change: I359V

PolyPhen 2 Score 0.182 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000057645
Gene: ENSMUSG00000030600
AA Change: I359V

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
LRR 88 111 8.67e-1 SMART
LRR 112 135 4.57e0 SMART
LRR_TYP 136 159 1.69e-3 SMART
LRR 161 184 2.54e1 SMART
LRR 185 208 2.32e-1 SMART
LRR 209 233 3.75e0 SMART
LRRCT 252 297 1.36e-3 SMART
IGc2 312 377 1.51e-12 SMART
low complexity region 389 403 N/A INTRINSIC
low complexity region 460 471 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108288
AA Change: I359V

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103923
Gene: ENSMUSG00000030600
AA Change: I359V

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
LRR 88 111 8.67e-1 SMART
LRR 112 135 4.57e0 SMART
LRR_TYP 136 159 1.69e-3 SMART
LRR 161 184 2.54e1 SMART
LRR 185 208 2.32e-1 SMART
LRR 209 233 3.75e0 SMART
LRRCT 252 297 1.36e-3 SMART
IGc2 312 377 1.51e-12 SMART
low complexity region 389 403 N/A INTRINSIC
FN3 422 502 2.68e-2 SMART
transmembrane domain 535 557 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 609 625 N/A INTRINSIC
low complexity region 716 725 N/A INTRINSIC
low complexity region 730 747 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189877
AA Change: I359V

PolyPhen 2 Score 0.182 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000139609
Gene: ENSMUSG00000030600
AA Change: I359V

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
LRR 88 111 8.67e-1 SMART
LRR 112 135 4.57e0 SMART
LRR_TYP 136 159 1.69e-3 SMART
LRR 161 184 2.54e1 SMART
LRR 185 208 2.32e-1 SMART
LRR 209 233 3.75e0 SMART
LRRCT 252 297 1.36e-3 SMART
IGc2 312 377 1.51e-12 SMART
low complexity region 389 403 N/A INTRINSIC
low complexity region 460 471 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190954
SMART Domains Protein: ENSMUSP00000140537
Gene: ENSMUSG00000030600

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Blast:LRRNT 33 69 2e-18 BLAST
LRR 88 111 3.7e-3 SMART
LRR 112 135 1.9e-2 SMART
LRR_TYP 136 159 7.1e-6 SMART
LRR 161 184 1.1e-1 SMART
LRR 185 208 1e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
4933412E24Rik A G 15: 60,015,118 I491T probably damaging Het
Alkal2 G T 12: 30,884,851 G23V probably damaging Het
Ankrd40 G T 11: 94,334,836 G231V probably damaging Het
Ap1s3 T C 1: 79,623,728 E82G probably damaging Het
Bmp3 A G 5: 98,855,389 N93D probably damaging Het
Car9 C T 4: 43,509,021 R224C probably damaging Het
Cass4 T C 2: 172,427,794 C599R probably benign Het
Ccdc171 A G 4: 83,864,253 N1261D possibly damaging Het
Cdc42bpa A G 1: 180,162,144 D1726G probably damaging Het
Ceacam2 G A 7: 25,518,172 A306V probably damaging Het
Crebrf G T 17: 26,762,289 L546F probably damaging Het
Crhr2 A G 6: 55,092,956 F370S probably damaging Het
Dhtkd1 T C 2: 5,917,888 T487A probably benign Het
Diaph1 G A 18: 37,891,953 A485V unknown Het
Dmbt1 T C 7: 131,106,465 V1479A probably damaging Het
Efemp1 C T 11: 28,921,765 R427W probably damaging Het
Gm11444 C A 11: 85,850,249 W28L Het
Gm436 C G 4: 144,670,599 V188L probably benign Het
Golga4 A G 9: 118,558,322 D1504G probably benign Het
Hirip3 A G 7: 126,863,585 S238G probably benign Het
Igkv1-135 T A 6: 67,610,394 V83D possibly damaging Het
Ippk T A 13: 49,435,579 C183* probably null Het
Itgb3 A G 11: 104,642,316 T419A possibly damaging Het
Kcnt1 A G 2: 25,907,271 H129R probably benign Het
Kif18b A T 11: 102,916,473 V12E probably damaging Het
Kif2b C A 11: 91,576,375 G361C possibly damaging Het
Klhl30 A T 1: 91,357,772 K339* probably null Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ndufaf2 C A 13: 108,052,853 L120F probably damaging Het
Nlrp1b A G 11: 71,161,719 V961A possibly damaging Het
Olfr1145 T A 2: 87,810,050 Y77N probably damaging Het
Olfr132 A G 17: 38,130,787 V135A probably benign Het
Pcnx2 G A 8: 125,760,910 P1785S probably damaging Het
Pcyt2 A G 11: 120,613,408 Y170H probably benign Het
Rfx8 T A 1: 39,670,421 D482V probably damaging Het
Rilpl1 T C 5: 124,530,901 Y28C probably damaging Het
Sgce G C 6: 4,689,760 L394V probably damaging Het
Sgce T A 6: 4,691,525 Y350F probably benign Het
Tbk1 A G 10: 121,578,692 V39A probably damaging Het
Tns1 T A 1: 73,937,246 I1148F probably damaging Het
Vmn1r192 T A 13: 22,187,859 R64* probably null Het
Vmn2r68 A T 7: 85,221,900 V725E probably benign Het
Yy1 A T 12: 108,793,636 H75L unknown Het
Zwilch A T 9: 64,152,958 V366D possibly damaging Het
Other mutations in Lrfn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Lrfn1 APN 7 28460017 missense probably damaging 1.00
IGL01565:Lrfn1 APN 7 28458769 missense probably damaging 1.00
IGL01622:Lrfn1 APN 7 28466686 missense probably damaging 1.00
IGL01623:Lrfn1 APN 7 28466686 missense probably damaging 1.00
IGL02176:Lrfn1 APN 7 28458686 intron probably benign
IGL02642:Lrfn1 APN 7 28458688 intron probably benign
R1123:Lrfn1 UTSW 7 28467119 missense possibly damaging 0.71
R1838:Lrfn1 UTSW 7 28459768 missense probably damaging 0.98
R3000:Lrfn1 UTSW 7 28467407 missense probably damaging 1.00
R3551:Lrfn1 UTSW 7 28460054 missense possibly damaging 0.90
R3905:Lrfn1 UTSW 7 28466869 missense possibly damaging 0.49
R4246:Lrfn1 UTSW 7 28459942 missense probably benign 0.03
R5621:Lrfn1 UTSW 7 28466836 missense probably damaging 1.00
R6267:Lrfn1 UTSW 7 28459744 missense probably benign 0.01
R6902:Lrfn1 UTSW 7 28459813 missense probably benign 0.10
R7059:Lrfn1 UTSW 7 28466930 missense possibly damaging 0.65
R7073:Lrfn1 UTSW 7 28459972 missense possibly damaging 0.94
R7208:Lrfn1 UTSW 7 28467139 missense probably benign
R7402:Lrfn1 UTSW 7 28459522 missense probably damaging 1.00
Z1176:Lrfn1 UTSW 7 28459115 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- AGGAATTTCTATGTGAGCCCC -3'
(R):5'- TGAGTTCAGCAGCCACAAGC -3'

Sequencing Primer
(F):5'- CCGCTCATCACACGGCAAG -3'
(R):5'- TGAGTCGTTGGCACCAGGTC -3'
Posted On2020-09-02