Incidental Mutation 'R8378:Gm11444'
ID 646817
Institutional Source Beutler Lab
Gene Symbol Gm11444
Ensembl Gene ENSMUSG00000069785
Gene Name predicted gene 11444
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock # R8378 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 85846790-85850333 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 85850249 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Leucine at position 28 (W28L)
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000116236
Gene: ENSMUSG00000069785
AA Change: W28L

DomainStartEndE-ValueType
low complexity region 130 143 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
4933412E24Rik A G 15: 60,015,118 I491T probably damaging Het
Alkal2 G T 12: 30,884,851 G23V probably damaging Het
Ankrd40 G T 11: 94,334,836 G231V probably damaging Het
Ap1s3 T C 1: 79,623,728 E82G probably damaging Het
Bmp3 A G 5: 98,855,389 N93D probably damaging Het
Car9 C T 4: 43,509,021 R224C probably damaging Het
Cass4 T C 2: 172,427,794 C599R probably benign Het
Ccdc171 A G 4: 83,864,253 N1261D possibly damaging Het
Cdc42bpa A G 1: 180,162,144 D1726G probably damaging Het
Ceacam2 G A 7: 25,518,172 A306V probably damaging Het
Crebrf G T 17: 26,762,289 L546F probably damaging Het
Crhr2 A G 6: 55,092,956 F370S probably damaging Het
Dhtkd1 T C 2: 5,917,888 T487A probably benign Het
Diaph1 G A 18: 37,891,953 A485V unknown Het
Dmbt1 T C 7: 131,106,465 V1479A probably damaging Het
Efemp1 C T 11: 28,921,765 R427W probably damaging Het
Gm436 C G 4: 144,670,599 V188L probably benign Het
Golga4 A G 9: 118,558,322 D1504G probably benign Het
Hirip3 A G 7: 126,863,585 S238G probably benign Het
Igkv1-135 T A 6: 67,610,394 V83D possibly damaging Het
Ippk T A 13: 49,435,579 C183* probably null Het
Itgb3 A G 11: 104,642,316 T419A possibly damaging Het
Kcnt1 A G 2: 25,907,271 H129R probably benign Het
Kif18b A T 11: 102,916,473 V12E probably damaging Het
Kif2b C A 11: 91,576,375 G361C possibly damaging Het
Klhl30 A T 1: 91,357,772 K339* probably null Het
Lrfn1 A G 7: 28,459,732 I359V probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ndufaf2 C A 13: 108,052,853 L120F probably damaging Het
Nlrp1b A G 11: 71,161,719 V961A possibly damaging Het
Olfr1145 T A 2: 87,810,050 Y77N probably damaging Het
Olfr132 A G 17: 38,130,787 V135A probably benign Het
Pcnx2 G A 8: 125,760,910 P1785S probably damaging Het
Pcyt2 A G 11: 120,613,408 Y170H probably benign Het
Rfx8 T A 1: 39,670,421 D482V probably damaging Het
Rilpl1 T C 5: 124,530,901 Y28C probably damaging Het
Sgce G C 6: 4,689,760 L394V probably damaging Het
Sgce T A 6: 4,691,525 Y350F probably benign Het
Tbk1 A G 10: 121,578,692 V39A probably damaging Het
Tns1 T A 1: 73,937,246 I1148F probably damaging Het
Vmn1r192 T A 13: 22,187,859 R64* probably null Het
Vmn2r68 A T 7: 85,221,900 V725E probably benign Het
Yy1 A T 12: 108,793,636 H75L unknown Het
Zwilch A T 9: 64,152,958 V366D possibly damaging Het
Other mutations in Gm11444
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01298:Gm11444 APN 11 85848094 missense unknown
R1958:Gm11444 UTSW 11 85848173 splice site probably benign
R5199:Gm11444 UTSW 11 85848019 missense unknown
R6283:Gm11444 UTSW 11 85846791 splice site probably null
R7088:Gm11444 UTSW 11 85847036 missense
R7579:Gm11444 UTSW 11 85850243 missense unknown
R8708:Gm11444 UTSW 11 85846897 missense
Predicted Primers PCR Primer
(F):5'- GAGAGATCTCTGTGCTGTTCC -3'
(R):5'- CAGGGTATCACAGAGAACCATTG -3'

Sequencing Primer
(F):5'- TGCAGTGTCCCAGGTGTAC -3'
(R):5'- AGAGAACCATTGCCCTGGC -3'
Posted On 2020-09-02