Incidental Mutation 'R8378:Kif2b'
ID 646818
Institutional Source Beutler Lab
Gene Symbol Kif2b
Ensembl Gene ENSMUSG00000046755
Gene Name kinesin family member 2B
Synonyms 1700063D03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.794) question?
Stock # R8378 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 91575315-91577558 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 91576375 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Cysteine at position 361 (G361C)
Ref Sequence ENSEMBL: ENSMUSP00000058084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061019]
AlphaFold Q8C0N1
Predicted Effect possibly damaging
Transcript: ENSMUST00000061019
AA Change: G361C

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058084
Gene: ENSMUSG00000046755
AA Change: G361C

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 151 176 N/A INTRINSIC
KISc 211 549 2.34e-134 SMART
low complexity region 588 603 N/A INTRINSIC
coiled coil region 640 664 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
4933412E24Rik A G 15: 60,015,118 I491T probably damaging Het
Alkal2 G T 12: 30,884,851 G23V probably damaging Het
Ankrd40 G T 11: 94,334,836 G231V probably damaging Het
Ap1s3 T C 1: 79,623,728 E82G probably damaging Het
Bmp3 A G 5: 98,855,389 N93D probably damaging Het
Car9 C T 4: 43,509,021 R224C probably damaging Het
Cass4 T C 2: 172,427,794 C599R probably benign Het
Ccdc171 A G 4: 83,864,253 N1261D possibly damaging Het
Cdc42bpa A G 1: 180,162,144 D1726G probably damaging Het
Ceacam2 G A 7: 25,518,172 A306V probably damaging Het
Crebrf G T 17: 26,762,289 L546F probably damaging Het
Crhr2 A G 6: 55,092,956 F370S probably damaging Het
Dhtkd1 T C 2: 5,917,888 T487A probably benign Het
Diaph1 G A 18: 37,891,953 A485V unknown Het
Dmbt1 T C 7: 131,106,465 V1479A probably damaging Het
Efemp1 C T 11: 28,921,765 R427W probably damaging Het
Gm11444 C A 11: 85,850,249 W28L Het
Gm436 C G 4: 144,670,599 V188L probably benign Het
Golga4 A G 9: 118,558,322 D1504G probably benign Het
Hirip3 A G 7: 126,863,585 S238G probably benign Het
Igkv1-135 T A 6: 67,610,394 V83D possibly damaging Het
Ippk T A 13: 49,435,579 C183* probably null Het
Itgb3 A G 11: 104,642,316 T419A possibly damaging Het
Kcnt1 A G 2: 25,907,271 H129R probably benign Het
Kif18b A T 11: 102,916,473 V12E probably damaging Het
Klhl30 A T 1: 91,357,772 K339* probably null Het
Lrfn1 A G 7: 28,459,732 I359V probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ndufaf2 C A 13: 108,052,853 L120F probably damaging Het
Nlrp1b A G 11: 71,161,719 V961A possibly damaging Het
Olfr1145 T A 2: 87,810,050 Y77N probably damaging Het
Olfr132 A G 17: 38,130,787 V135A probably benign Het
Pcnx2 G A 8: 125,760,910 P1785S probably damaging Het
Pcyt2 A G 11: 120,613,408 Y170H probably benign Het
Rfx8 T A 1: 39,670,421 D482V probably damaging Het
Rilpl1 T C 5: 124,530,901 Y28C probably damaging Het
Sgce G C 6: 4,689,760 L394V probably damaging Het
Sgce T A 6: 4,691,525 Y350F probably benign Het
Tbk1 A G 10: 121,578,692 V39A probably damaging Het
Tns1 T A 1: 73,937,246 I1148F probably damaging Het
Vmn1r192 T A 13: 22,187,859 R64* probably null Het
Vmn2r68 A T 7: 85,221,900 V725E probably benign Het
Yy1 A T 12: 108,793,636 H75L unknown Het
Zwilch A T 9: 64,152,958 V366D possibly damaging Het
Other mutations in Kif2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Kif2b APN 11 91576380 missense probably damaging 1.00
IGL01459:Kif2b APN 11 91577023 missense possibly damaging 0.65
IGL01468:Kif2b APN 11 91576365 missense probably damaging 1.00
IGL02897:Kif2b APN 11 91576219 missense probably damaging 1.00
R0076:Kif2b UTSW 11 91575909 missense probably damaging 1.00
R0488:Kif2b UTSW 11 91576972 missense probably benign 0.00
R0524:Kif2b UTSW 11 91575724 missense probably benign 0.00
R0549:Kif2b UTSW 11 91576584 missense probably damaging 1.00
R0893:Kif2b UTSW 11 91575594 missense probably benign 0.16
R1677:Kif2b UTSW 11 91575972 missense probably damaging 1.00
R2025:Kif2b UTSW 11 91577346 missense probably damaging 0.99
R2185:Kif2b UTSW 11 91576971 frame shift probably null
R2290:Kif2b UTSW 11 91575696 missense probably benign 0.00
R4697:Kif2b UTSW 11 91576846 missense probably benign 0.01
R4785:Kif2b UTSW 11 91576428 missense probably benign 0.07
R5429:Kif2b UTSW 11 91577229 missense probably benign 0.03
R5555:Kif2b UTSW 11 91575460 missense probably benign 0.00
R5652:Kif2b UTSW 11 91575830 missense possibly damaging 0.86
R5765:Kif2b UTSW 11 91577242 missense probably benign 0.28
R6101:Kif2b UTSW 11 91575988 missense probably benign 0.00
R6105:Kif2b UTSW 11 91575988 missense probably benign 0.00
R6450:Kif2b UTSW 11 91576366 missense probably damaging 0.99
R6862:Kif2b UTSW 11 91575915 missense probably damaging 1.00
R7097:Kif2b UTSW 11 91576824 missense probably benign 0.00
R7189:Kif2b UTSW 11 91577137 missense probably benign 0.01
R7507:Kif2b UTSW 11 91577443 missense probably benign
R7742:Kif2b UTSW 11 91576585 missense possibly damaging 0.85
R7818:Kif2b UTSW 11 91576126 missense probably damaging 1.00
R7820:Kif2b UTSW 11 91577274 missense probably benign 0.01
R7946:Kif2b UTSW 11 91575745 missense probably benign 0.00
R8442:Kif2b UTSW 11 91576314 missense possibly damaging 0.54
R8925:Kif2b UTSW 11 91577197 missense probably benign 0.00
R8927:Kif2b UTSW 11 91577197 missense probably benign 0.00
R8969:Kif2b UTSW 11 91577193 missense probably benign 0.00
R9002:Kif2b UTSW 11 91576227 missense probably benign 0.30
R9028:Kif2b UTSW 11 91577185 missense probably benign
R9039:Kif2b UTSW 11 91576305 missense possibly damaging 0.91
R9063:Kif2b UTSW 11 91575828 missense probably damaging 1.00
R9114:Kif2b UTSW 11 91575712 missense possibly damaging 0.77
R9279:Kif2b UTSW 11 91577149 missense probably benign 0.01
Z1176:Kif2b UTSW 11 91576264 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTTGAGAATGAGCTGGAACAC -3'
(R):5'- GCAACTTGCTTTGCCTACG -3'

Sequencing Primer
(F):5'- TGGAACACAGCATGGCTC -3'
(R):5'- TACGGGCAGACTGGCAG -3'
Posted On 2020-09-02