Incidental Mutation 'R8378:Kif2b'
ID646818
Institutional Source Beutler Lab
Gene Symbol Kif2b
Ensembl Gene ENSMUSG00000046755
Gene Namekinesin family member 2B
Synonyms1700063D03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.700) question?
Stock #R8378 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location91575315-91577558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 91576375 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 361 (G361C)
Ref Sequence ENSEMBL: ENSMUSP00000058084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061019]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061019
AA Change: G361C

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058084
Gene: ENSMUSG00000046755
AA Change: G361C

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 151 176 N/A INTRINSIC
KISc 211 549 2.34e-134 SMART
low complexity region 588 603 N/A INTRINSIC
coiled coil region 640 664 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
4933412E24Rik A G 15: 60,015,118 I491T probably damaging Het
Alkal2 G T 12: 30,884,851 G23V probably damaging Het
Ankrd40 G T 11: 94,334,836 G231V probably damaging Het
Ap1s3 T C 1: 79,623,728 E82G probably damaging Het
Bmp3 A G 5: 98,855,389 N93D probably damaging Het
Car9 C T 4: 43,509,021 R224C probably damaging Het
Cass4 T C 2: 172,427,794 C599R probably benign Het
Ccdc171 A G 4: 83,864,253 N1261D possibly damaging Het
Cdc42bpa A G 1: 180,162,144 D1726G probably damaging Het
Ceacam2 G A 7: 25,518,172 A306V probably damaging Het
Crebrf G T 17: 26,762,289 L546F probably damaging Het
Crhr2 A G 6: 55,092,956 F370S probably damaging Het
Dhtkd1 T C 2: 5,917,888 T487A probably benign Het
Diaph1 G A 18: 37,891,953 A485V unknown Het
Dmbt1 T C 7: 131,106,465 V1479A probably damaging Het
Efemp1 C T 11: 28,921,765 R427W probably damaging Het
Gm11444 C A 11: 85,850,249 W28L Het
Gm436 C G 4: 144,670,599 V188L probably benign Het
Golga4 A G 9: 118,558,322 D1504G probably benign Het
Hirip3 A G 7: 126,863,585 S238G probably benign Het
Igkv1-135 T A 6: 67,610,394 V83D possibly damaging Het
Ippk T A 13: 49,435,579 C183* probably null Het
Itgb3 A G 11: 104,642,316 T419A possibly damaging Het
Kcnt1 A G 2: 25,907,271 H129R probably benign Het
Kif18b A T 11: 102,916,473 V12E probably damaging Het
Klhl30 A T 1: 91,357,772 K339* probably null Het
Lrfn1 A G 7: 28,459,732 I359V probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ndufaf2 C A 13: 108,052,853 L120F probably damaging Het
Nlrp1b A G 11: 71,161,719 V961A possibly damaging Het
Olfr1145 T A 2: 87,810,050 Y77N probably damaging Het
Olfr132 A G 17: 38,130,787 V135A probably benign Het
Pcnx2 G A 8: 125,760,910 P1785S probably damaging Het
Pcyt2 A G 11: 120,613,408 Y170H probably benign Het
Rfx8 T A 1: 39,670,421 D482V probably damaging Het
Rilpl1 T C 5: 124,530,901 Y28C probably damaging Het
Sgce G C 6: 4,689,760 L394V probably damaging Het
Sgce T A 6: 4,691,525 Y350F probably benign Het
Tbk1 A G 10: 121,578,692 V39A probably damaging Het
Tns1 T A 1: 73,937,246 I1148F probably damaging Het
Vmn1r192 T A 13: 22,187,859 R64* probably null Het
Vmn2r68 A T 7: 85,221,900 V725E probably benign Het
Yy1 A T 12: 108,793,636 H75L unknown Het
Zwilch A T 9: 64,152,958 V366D possibly damaging Het
Other mutations in Kif2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Kif2b APN 11 91576380 missense probably damaging 1.00
IGL01459:Kif2b APN 11 91577023 missense possibly damaging 0.65
IGL01468:Kif2b APN 11 91576365 missense probably damaging 1.00
IGL02897:Kif2b APN 11 91576219 missense probably damaging 1.00
R0076:Kif2b UTSW 11 91575909 missense probably damaging 1.00
R0488:Kif2b UTSW 11 91576972 missense probably benign 0.00
R0524:Kif2b UTSW 11 91575724 missense probably benign 0.00
R0549:Kif2b UTSW 11 91576584 missense probably damaging 1.00
R0893:Kif2b UTSW 11 91575594 missense probably benign 0.16
R1677:Kif2b UTSW 11 91575972 missense probably damaging 1.00
R2025:Kif2b UTSW 11 91577346 missense probably damaging 0.99
R2185:Kif2b UTSW 11 91576971 frame shift probably null
R2290:Kif2b UTSW 11 91575696 missense probably benign 0.00
R4697:Kif2b UTSW 11 91576846 missense probably benign 0.01
R4785:Kif2b UTSW 11 91576428 missense probably benign 0.07
R5429:Kif2b UTSW 11 91577229 missense probably benign 0.03
R5555:Kif2b UTSW 11 91575460 missense probably benign 0.00
R5652:Kif2b UTSW 11 91575830 missense possibly damaging 0.86
R5765:Kif2b UTSW 11 91577242 missense probably benign 0.28
R6101:Kif2b UTSW 11 91575988 missense probably benign 0.00
R6105:Kif2b UTSW 11 91575988 missense probably benign 0.00
R6450:Kif2b UTSW 11 91576366 missense probably damaging 0.99
R6862:Kif2b UTSW 11 91575915 missense probably damaging 1.00
R7097:Kif2b UTSW 11 91576824 missense probably benign 0.00
R7189:Kif2b UTSW 11 91577137 missense probably benign 0.01
R7507:Kif2b UTSW 11 91577443 missense probably benign
R7742:Kif2b UTSW 11 91576585 missense possibly damaging 0.85
R7818:Kif2b UTSW 11 91576126 missense probably damaging 1.00
R7820:Kif2b UTSW 11 91577274 missense probably benign 0.01
R7946:Kif2b UTSW 11 91575745 missense probably benign 0.00
R8442:Kif2b UTSW 11 91576314 missense possibly damaging 0.54
Z1176:Kif2b UTSW 11 91576264 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTTGAGAATGAGCTGGAACAC -3'
(R):5'- GCAACTTGCTTTGCCTACG -3'

Sequencing Primer
(F):5'- TGGAACACAGCATGGCTC -3'
(R):5'- TACGGGCAGACTGGCAG -3'
Posted On2020-09-02