Incidental Mutation 'R8379:Mkln1'
ID 646854
Institutional Source Beutler Lab
Gene Symbol Mkln1
Ensembl Gene ENSMUSG00000025609
Gene Name muskelin 1, intracellular mediator containing kelch motifs
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.751) question?
Stock # R8379 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 31398735-31516811 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 31458965 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 286 (Y286*)
Ref Sequence ENSEMBL: ENSMUSP00000026699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026699]
AlphaFold O89050
PDB Structure The crystal structure of discoidin domain from muskelin [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000026699
AA Change: Y286*
SMART Domains Protein: ENSMUSP00000026699
Gene: ENSMUSG00000025609
AA Change: Y286*

DomainStartEndE-ValueType
Pfam:F5_F8_type_C 20 150 5.8e-11 PFAM
LisH 172 204 4.68e-3 SMART
CTLH 206 258 5.29e-2 SMART
Pfam:Kelch_4 270 324 5.8e-7 PFAM
Pfam:Kelch_1 279 315 2.2e-8 PFAM
Pfam:Kelch_3 282 334 7.6e-13 PFAM
Pfam:Kelch_1 459 498 2.8e-6 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Muskelin is an intracellular protein that acts as a mediator of cell spreading and cytoskeletal responses to the extracellular matrix component thrombospondin I (MIM 188060) (Adams et al., 1998 [PubMed 9724633]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit abnormal high-frequency ripple oscillation associated with GABA receptor internalization, intracellular trafficking, and degradation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aipl1 T C 11: 72,029,300 D314G probably benign Het
Ankrd12 T G 17: 65,983,944 E1498A probably benign Het
Appl1 A T 14: 26,925,415 probably null Het
Auh A G 13: 52,909,313 *116R probably null Het
Ccdc7a T A 8: 128,964,936 H402L probably benign Het
Ccr4 T C 9: 114,492,167 T277A probably benign Het
Col18a1 C T 10: 77,053,238 V1302I probably benign Het
Csnk1a1 T C 18: 61,555,854 I35T probably benign Het
Csnk1e T C 15: 79,420,682 R374G possibly damaging Het
Ddx11 A G 17: 66,130,025 R105G probably benign Het
Denr C A 5: 123,927,061 T159K possibly damaging Het
Dmp1 C A 5: 104,211,705 Y82* probably null Het
Dok3 A G 13: 55,524,020 V246A probably benign Het
Endov A C 11: 119,491,897 K57Q possibly damaging Het
Fam160a2 T C 7: 105,385,135 N430D possibly damaging Het
Fam83a A G 15: 58,009,800 T342A probably benign Het
Fbln1 G A 15: 85,232,572 C275Y probably damaging Het
Foxi1 A G 11: 34,207,530 I165T possibly damaging Het
Gm14496 A T 2: 182,000,482 I649F probably damaging Het
Gm9268 C T 7: 43,047,846 P776S probably damaging Het
Grin2b A G 6: 135,922,969 S305P probably damaging Het
Grm1 G A 10: 10,689,135 T1143M possibly damaging Het
Ifi202b C A 1: 173,974,732 probably null Het
Klhl32 A T 4: 24,629,194 D491E probably damaging Het
Klk1b1 C T 7: 43,970,343 R109C possibly damaging Het
Krt13 A G 11: 100,118,880 L358P probably damaging Het
Limk2 G A 11: 3,371,162 probably benign Het
Mdn1 A G 4: 32,756,453 D4720G probably null Het
Muc6 C A 7: 141,644,312 E1143* probably null Het
Myh15 A G 16: 49,081,188 I242M probably benign Het
Noc4l T G 5: 110,650,962 K241Q probably damaging Het
Nup88 C A 11: 70,969,781 L57F possibly damaging Het
Obsl1 G T 1: 75,503,857 F374L possibly damaging Het
Olfr612 A G 7: 103,538,976 I86T possibly damaging Het
Orm1 A T 4: 63,346,118 D137V probably damaging Het
Osbpl2 T A 2: 180,137,102 D9E probably damaging Het
P4ha3 G T 7: 100,293,779 D124Y probably damaging Het
Poteg T C 8: 27,453,326 V208A probably benign Het
Ppfibp1 A G 6: 147,030,345 D963G probably damaging Het
Prdx6 G T 1: 161,251,090 D9E probably benign Het
Prrc2b C A 2: 32,214,654 N1381K probably damaging Het
Ptpn14 T A 1: 189,833,401 V222E possibly damaging Het
Rasal1 C T 5: 120,666,355 R431C probably benign Het
Rexo5 A T 7: 119,834,285 M422L probably benign Het
Rnf17 TG T 14: 56,424,542 132 probably null Het
Robo2 A T 16: 73,933,700 I1008N probably damaging Het
Sidt1 T A 16: 44,286,392 Y225F probably benign Het
Slc6a15 A T 10: 103,389,187 E45D probably benign Het
Spata31d1a T G 13: 59,702,854 M487L probably benign Het
St6galnac1 C A 11: 116,775,499 probably benign Het
Tcp11l2 A G 10: 84,613,605 Y478C probably damaging Het
Tdrd12 G T 7: 35,524,057 C67* probably null Het
Tead2 G A 7: 45,218,081 G78D probably damaging Het
Tfpi2 A T 6: 3,963,849 N194K probably damaging Het
Timd2 A G 11: 46,677,200 probably null Het
Tmem270 T C 5: 134,901,703 T235A probably benign Het
Tnrc18 T C 5: 142,788,402 D224G Het
Tsga10 G T 1: 37,801,878 Q416K probably benign Het
Ulk1 C A 5: 110,787,665 L911F probably damaging Het
Usp8 T C 2: 126,742,571 S567P probably benign Het
Zdhhc3 A C 9: 123,089,078 C129G probably damaging Het
Other mutations in Mkln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Mkln1 APN 6 31432990 missense probably damaging 0.99
IGL01569:Mkln1 APN 6 31428128 splice site probably benign
IGL01882:Mkln1 APN 6 31451534 missense probably benign
IGL02009:Mkln1 APN 6 31449520 missense probably benign 0.02
IGL02160:Mkln1 APN 6 31492791 splice site probably benign
IGL02994:Mkln1 APN 6 31490443 missense probably damaging 1.00
IGL03105:Mkln1 APN 6 31459059 nonsense probably null
PIT4377001:Mkln1 UTSW 6 31474354 missense probably damaging 1.00
R0376:Mkln1 UTSW 6 31478018 missense probably benign 0.00
R0446:Mkln1 UTSW 6 31449504 missense probably damaging 0.98
R0518:Mkln1 UTSW 6 31468132 missense probably benign 0.00
R0600:Mkln1 UTSW 6 31432927 splice site probably benign
R1066:Mkln1 UTSW 6 31418987 missense possibly damaging 0.85
R1248:Mkln1 UTSW 6 31489368 missense probably damaging 1.00
R1717:Mkln1 UTSW 6 31507644 missense probably benign
R1921:Mkln1 UTSW 6 31428178 missense probably benign 0.22
R1978:Mkln1 UTSW 6 31490530 nonsense probably null
R3836:Mkln1 UTSW 6 31468336 missense probably damaging 1.00
R3895:Mkln1 UTSW 6 31507667 missense probably damaging 1.00
R4456:Mkln1 UTSW 6 31426772 missense probably damaging 1.00
R4513:Mkln1 UTSW 6 31433158 intron probably benign
R4737:Mkln1 UTSW 6 31426799 missense probably damaging 1.00
R4819:Mkln1 UTSW 6 31474486 missense probably benign 0.00
R4960:Mkln1 UTSW 6 31459006 missense probably damaging 1.00
R5291:Mkln1 UTSW 6 31490481 missense possibly damaging 0.78
R5364:Mkln1 UTSW 6 31496712 missense probably damaging 1.00
R5739:Mkln1 UTSW 6 31496702 missense probably benign 0.00
R5797:Mkln1 UTSW 6 31433069 missense probably benign 0.21
R5890:Mkln1 UTSW 6 31490547 missense probably benign 0.02
R5940:Mkln1 UTSW 6 31489372 missense probably damaging 1.00
R6132:Mkln1 UTSW 6 31431220 missense probably damaging 0.98
R6521:Mkln1 UTSW 6 31490544 missense probably damaging 1.00
R7362:Mkln1 UTSW 6 31468168 missense probably benign 0.31
R7711:Mkln1 UTSW 6 31492649 missense probably damaging 0.99
R8094:Mkln1 UTSW 6 31492653 nonsense probably null
R8340:Mkln1 UTSW 6 31432943 missense possibly damaging 0.53
R8972:Mkln1 UTSW 6 31496746 missense probably damaging 1.00
R9403:Mkln1 UTSW 6 31432970 missense probably damaging 1.00
Z1176:Mkln1 UTSW 6 31398921 missense possibly damaging 0.74
Z1176:Mkln1 UTSW 6 31451554 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAAAATACAGTTCTGAAGCAGTC -3'
(R):5'- TGCTACAACTATAGGGAAACATCAG -3'

Sequencing Primer
(F):5'- AGTCTTTGCACATACTTAGGTTTAAG -3'
(R):5'- ACATCAGAGAAGAAAATAAGCATGC -3'
Posted On 2020-09-02