Incidental Mutation 'R8379:Grin2b'
ID646855
Institutional Source Beutler Lab
Gene Symbol Grin2b
Ensembl Gene ENSMUSG00000030209
Gene Nameglutamate receptor, ionotropic, NMDA2B (epsilon 2)
SynonymsGluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8379 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location135713233-136173511 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135922969 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 305 (S305P)
Ref Sequence ENSEMBL: ENSMUSP00000142696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905] [ENSMUST00000152012]
Predicted Effect probably damaging
Transcript: ENSMUST00000053880
AA Change: S305P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: S305P

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 106 306 8.6e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 4.8e-270 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111905
AA Change: S305P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: S305P

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 56 307 4.2e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 2.1e-245 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000152012
AA Change: S305P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142696
Gene: ENSMUSG00000030209
AA Change: S305P

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 66 312 1.6e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aipl1 T C 11: 72,029,300 D314G probably benign Het
Ankrd12 T G 17: 65,983,944 E1498A probably benign Het
Appl1 A T 14: 26,925,415 probably null Het
Auh A G 13: 52,909,313 *116R probably null Het
Ccdc7a T A 8: 128,964,936 H402L probably benign Het
Ccr4 T C 9: 114,492,167 T277A probably benign Het
Col18a1 C T 10: 77,053,238 V1302I probably benign Het
Csnk1a1 T C 18: 61,555,854 I35T probably benign Het
Csnk1e T C 15: 79,420,682 R374G possibly damaging Het
Ddx11 A G 17: 66,130,025 R105G probably benign Het
Denr C A 5: 123,927,061 T159K possibly damaging Het
Dmp1 C A 5: 104,211,705 Y82* probably null Het
Dok3 A G 13: 55,524,020 V246A probably benign Het
Endov A C 11: 119,491,897 K57Q possibly damaging Het
Fam160a2 T C 7: 105,385,135 N430D possibly damaging Het
Fam83a A G 15: 58,009,800 T342A probably benign Het
Fbln1 G A 15: 85,232,572 C275Y probably damaging Het
Foxi1 A G 11: 34,207,530 I165T possibly damaging Het
Gm14496 A T 2: 182,000,482 I649F probably damaging Het
Gm9268 C T 7: 43,047,846 P776S probably damaging Het
Grm1 G A 10: 10,689,135 T1143M possibly damaging Het
Ifi202b C A 1: 173,974,732 probably null Het
Klhl32 A T 4: 24,629,194 D491E probably damaging Het
Klk1b1 C T 7: 43,970,343 R109C possibly damaging Het
Krt13 A G 11: 100,118,880 L358P probably damaging Het
Limk2 G A 11: 3,371,162 probably benign Het
Mdn1 A G 4: 32,756,453 D4720G probably null Het
Mkln1 T A 6: 31,458,965 Y286* probably null Het
Muc6 C A 7: 141,644,312 E1143* probably null Het
Myh15 A G 16: 49,081,188 I242M probably benign Het
Noc4l T G 5: 110,650,962 K241Q probably damaging Het
Nup88 C A 11: 70,969,781 L57F possibly damaging Het
Obsl1 G T 1: 75,503,857 F374L possibly damaging Het
Olfr612 A G 7: 103,538,976 I86T possibly damaging Het
Orm1 A T 4: 63,346,118 D137V probably damaging Het
Osbpl2 T A 2: 180,137,102 D9E probably damaging Het
P4ha3 G T 7: 100,293,779 D124Y probably damaging Het
Pgap3 TCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAG 11: 98,390,749 probably benign Het
Poteg T C 8: 27,453,326 V208A probably benign Het
Ppfibp1 A G 6: 147,030,345 D963G probably damaging Het
Prdx6 G T 1: 161,251,090 D9E probably benign Het
Prrc2b C A 2: 32,214,654 N1381K probably damaging Het
Ptpn14 T A 1: 189,833,401 V222E possibly damaging Het
Rasal1 C T 5: 120,666,355 R431C probably benign Het
Rexo5 A T 7: 119,834,285 M422L probably benign Het
Rnf17 TG T 14: 56,424,542 probably null Het
Robo2 A T 16: 73,933,700 I1008N probably damaging Het
Sidt1 T A 16: 44,286,392 Y225F probably benign Het
Slc6a15 A T 10: 103,389,187 E45D probably benign Het
Spata31d1a T G 13: 59,702,854 M487L probably benign Het
St6galnac1 C A 11: 116,775,499 probably benign Het
Tcp11l2 A G 10: 84,613,605 Y478C probably damaging Het
Tdrd12 G T 7: 35,524,057 C67* probably null Het
Tead2 G A 7: 45,218,081 G78D probably damaging Het
Tfpi2 A T 6: 3,963,849 N194K probably damaging Het
Tmem270 T C 5: 134,901,703 T235A probably benign Het
Tnrc18 T C 5: 142,788,402 D224G Het
Tsga10 G T 1: 37,801,878 Q416K probably benign Het
Ulk1 C A 5: 110,787,665 L911F probably damaging Het
Usp8 T C 2: 126,742,571 S567P probably benign Het
Zdhhc3 A C 9: 123,089,078 C129G probably damaging Het
Other mutations in Grin2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Grin2b APN 6 135736331 missense possibly damaging 0.55
IGL00835:Grin2b APN 6 135733570 missense probably damaging 1.00
IGL01401:Grin2b APN 6 135736363 missense probably damaging 1.00
IGL01523:Grin2b APN 6 136044265 missense probably null 0.99
IGL01719:Grin2b APN 6 135733381 missense probably damaging 0.97
IGL01907:Grin2b APN 6 135733740 missense probably damaging 1.00
IGL01996:Grin2b APN 6 135732586 missense probably damaging 1.00
IGL02309:Grin2b APN 6 135736472 missense probably damaging 1.00
IGL02312:Grin2b APN 6 135739090 missense probably damaging 1.00
IGL02409:Grin2b APN 6 136043908 missense possibly damaging 0.89
IGL02527:Grin2b APN 6 135923391 missense probably damaging 1.00
IGL02535:Grin2b APN 6 135779369 missense possibly damaging 0.70
IGL02570:Grin2b APN 6 135922998 missense probably damaging 1.00
IGL02702:Grin2b APN 6 135739132 missense probably damaging 0.99
IGL03001:Grin2b APN 6 135739115 missense probably damaging 1.00
IGL03274:Grin2b APN 6 135780255 missense possibly damaging 0.90
R0055:Grin2b UTSW 6 135923203 missense probably benign
R0055:Grin2b UTSW 6 135923203 missense probably benign
R0164:Grin2b UTSW 6 135778648 splice site probably benign
R0194:Grin2b UTSW 6 135779305 missense probably damaging 1.00
R0594:Grin2b UTSW 6 135733929 missense probably damaging 1.00
R1434:Grin2b UTSW 6 135843195 missense probably benign 0.04
R1928:Grin2b UTSW 6 136044046 missense probably damaging 1.00
R1942:Grin2b UTSW 6 135732732 missense possibly damaging 0.93
R1996:Grin2b UTSW 6 136044211 missense possibly damaging 0.52
R2002:Grin2b UTSW 6 135733245 missense probably damaging 1.00
R2020:Grin2b UTSW 6 135733896 missense probably benign 0.12
R2103:Grin2b UTSW 6 135780140 missense probably benign 0.02
R2127:Grin2b UTSW 6 135778700 missense probably benign 0.03
R2495:Grin2b UTSW 6 135733182 missense probably damaging 1.00
R2656:Grin2b UTSW 6 135733429 missense probably damaging 1.00
R2847:Grin2b UTSW 6 135740953 missense probably damaging 1.00
R2866:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R2867:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R2867:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R3196:Grin2b UTSW 6 135732455 small deletion probably benign
R3418:Grin2b UTSW 6 135843110 missense probably benign 0.02
R3808:Grin2b UTSW 6 135923271 missense probably damaging 0.99
R4028:Grin2b UTSW 6 135736435 missense probably damaging 1.00
R4602:Grin2b UTSW 6 135778741 missense probably damaging 1.00
R4624:Grin2b UTSW 6 135733825 missense probably damaging 0.99
R4677:Grin2b UTSW 6 135774872 missense probably benign 0.13
R4744:Grin2b UTSW 6 135778699 missense probably damaging 1.00
R5020:Grin2b UTSW 6 135733407 missense probably benign 0.01
R5051:Grin2b UTSW 6 135779395 missense possibly damaging 0.84
R5105:Grin2b UTSW 6 135732441 missense probably benign 0.03
R5125:Grin2b UTSW 6 135923299 missense possibly damaging 0.89
R5146:Grin2b UTSW 6 135779342 missense probably damaging 1.00
R5318:Grin2b UTSW 6 135733918 missense probably damaging 0.99
R5349:Grin2b UTSW 6 136044283 missense possibly damaging 0.93
R5426:Grin2b UTSW 6 135732368 missense probably damaging 1.00
R5438:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5439:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5440:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5530:Grin2b UTSW 6 135733723 missense probably benign 0.00
R5603:Grin2b UTSW 6 135923397 missense probably damaging 1.00
R5657:Grin2b UTSW 6 135733087 missense possibly damaging 0.48
R5788:Grin2b UTSW 6 135740964 missense probably benign 0.24
R5941:Grin2b UTSW 6 135736373 missense probably damaging 0.99
R6057:Grin2b UTSW 6 135733944 missense possibly damaging 0.84
R6137:Grin2b UTSW 6 135923458 missense possibly damaging 0.89
R6216:Grin2b UTSW 6 135772399 missense probably damaging 1.00
R6309:Grin2b UTSW 6 135733027 missense probably benign 0.00
R6316:Grin2b UTSW 6 135780279 missense probably benign 0.00
R6419:Grin2b UTSW 6 135740967 missense probably damaging 1.00
R6551:Grin2b UTSW 6 135733344 missense probably damaging 1.00
R6612:Grin2b UTSW 6 135740998 missense probably damaging 1.00
R6616:Grin2b UTSW 6 135732551 missense probably benign
R6647:Grin2b UTSW 6 135733110 missense probably damaging 1.00
R6806:Grin2b UTSW 6 135774828 missense possibly damaging 0.84
R6976:Grin2b UTSW 6 135780200 missense probably benign
R7033:Grin2b UTSW 6 135923038 missense probably damaging 1.00
R7058:Grin2b UTSW 6 135780306 missense probably damaging 0.97
R7144:Grin2b UTSW 6 135733476 missense possibly damaging 0.50
R7190:Grin2b UTSW 6 135732948 missense possibly damaging 0.46
R7238:Grin2b UTSW 6 135780251 missense probably damaging 0.97
R7453:Grin2b UTSW 6 135740949 missense possibly damaging 0.56
R7553:Grin2b UTSW 6 135772396 missense possibly damaging 0.88
R7585:Grin2b UTSW 6 135779303 missense probably damaging 0.99
R7615:Grin2b UTSW 6 135923364 missense probably damaging 1.00
R7632:Grin2b UTSW 6 135732555 missense probably benign 0.02
R7779:Grin2b UTSW 6 135778794 nonsense probably null
R8058:Grin2b UTSW 6 135733227 missense probably damaging 1.00
R8084:Grin2b UTSW 6 135733488 missense probably benign 0.03
R8145:Grin2b UTSW 6 135732499 missense probably benign 0.01
R8308:Grin2b UTSW 6 135923076 missense probably damaging 0.99
R8357:Grin2b UTSW 6 135732199 missense probably benign 0.00
R8429:Grin2b UTSW 6 135733916 missense probably damaging 1.00
R8457:Grin2b UTSW 6 135732199 missense probably benign 0.00
RF001:Grin2b UTSW 6 136044240 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCTGCCATTCTGAACGAC -3'
(R):5'- GTAGCTAACTCAGTTGGGCTG -3'

Sequencing Primer
(F):5'- GAACGACCAATCCCTGCTCTTG -3'
(R):5'- TGACTGGCTACGGCTACACATG -3'
Posted On2020-09-02