Incidental Mutation 'R8379:Slc6a15'
ID 646873
Institutional Source Beutler Lab
Gene Symbol Slc6a15
Ensembl Gene ENSMUSG00000019894
Gene Name solute carrier family 6 (neurotransmitter transporter), member 15
Synonyms v7-3
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8379 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 103367783-103419377 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 103389187 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 45 (E45D)
Ref Sequence ENSEMBL: ENSMUSP00000073829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074204] [ENSMUST00000179636] [ENSMUST00000217905]
AlphaFold Q8BG16
Predicted Effect probably benign
Transcript: ENSMUST00000074204
AA Change: E45D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000073829
Gene: ENSMUSG00000019894
AA Change: E45D

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:SNF 61 644 2.2e-229 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179636
AA Change: E45D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000136676
Gene: ENSMUSG00000019894
AA Change: E45D

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:SNF 61 644 2.2e-229 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217905
AA Change: E45D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the solute carrier family 6 protein family which transports neutral amino acids. The encoded protein is thought to play a role in neuronal amino acid transport (PMID: 16185194) and may be associated with major depression (PMID: 21521612). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased synaptosome transport activities but exhibit no behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aipl1 T C 11: 72,029,300 D314G probably benign Het
Ankrd12 T G 17: 65,983,944 E1498A probably benign Het
Appl1 A T 14: 26,925,415 probably null Het
Auh A G 13: 52,909,313 *116R probably null Het
Ccdc7a T A 8: 128,964,936 H402L probably benign Het
Ccr4 T C 9: 114,492,167 T277A probably benign Het
Col18a1 C T 10: 77,053,238 V1302I probably benign Het
Csnk1a1 T C 18: 61,555,854 I35T probably benign Het
Csnk1e T C 15: 79,420,682 R374G possibly damaging Het
Ddx11 A G 17: 66,130,025 R105G probably benign Het
Denr C A 5: 123,927,061 T159K possibly damaging Het
Dmp1 C A 5: 104,211,705 Y82* probably null Het
Dok3 A G 13: 55,524,020 V246A probably benign Het
Endov A C 11: 119,491,897 K57Q possibly damaging Het
Fam160a2 T C 7: 105,385,135 N430D possibly damaging Het
Fam83a A G 15: 58,009,800 T342A probably benign Het
Fbln1 G A 15: 85,232,572 C275Y probably damaging Het
Foxi1 A G 11: 34,207,530 I165T possibly damaging Het
Gm14496 A T 2: 182,000,482 I649F probably damaging Het
Gm9268 C T 7: 43,047,846 P776S probably damaging Het
Grin2b A G 6: 135,922,969 S305P probably damaging Het
Grm1 G A 10: 10,689,135 T1143M possibly damaging Het
Ifi202b C A 1: 173,974,732 probably null Het
Klhl32 A T 4: 24,629,194 D491E probably damaging Het
Klk1b1 C T 7: 43,970,343 R109C possibly damaging Het
Krt13 A G 11: 100,118,880 L358P probably damaging Het
Limk2 G A 11: 3,371,162 probably benign Het
Mdn1 A G 4: 32,756,453 D4720G probably null Het
Mkln1 T A 6: 31,458,965 Y286* probably null Het
Muc6 C A 7: 141,644,312 E1143* probably null Het
Myh15 A G 16: 49,081,188 I242M probably benign Het
Noc4l T G 5: 110,650,962 K241Q probably damaging Het
Nup88 C A 11: 70,969,781 L57F possibly damaging Het
Obsl1 G T 1: 75,503,857 F374L possibly damaging Het
Olfr612 A G 7: 103,538,976 I86T possibly damaging Het
Orm1 A T 4: 63,346,118 D137V probably damaging Het
Osbpl2 T A 2: 180,137,102 D9E probably damaging Het
P4ha3 G T 7: 100,293,779 D124Y probably damaging Het
Poteg T C 8: 27,453,326 V208A probably benign Het
Ppfibp1 A G 6: 147,030,345 D963G probably damaging Het
Prdx6 G T 1: 161,251,090 D9E probably benign Het
Prrc2b C A 2: 32,214,654 N1381K probably damaging Het
Ptpn14 T A 1: 189,833,401 V222E possibly damaging Het
Rasal1 C T 5: 120,666,355 R431C probably benign Het
Rexo5 A T 7: 119,834,285 M422L probably benign Het
Rnf17 TG T 14: 56,424,542 132 probably null Het
Robo2 A T 16: 73,933,700 I1008N probably damaging Het
Sidt1 T A 16: 44,286,392 Y225F probably benign Het
Spata31d1a T G 13: 59,702,854 M487L probably benign Het
St6galnac1 C A 11: 116,775,499 probably benign Het
Tcp11l2 A G 10: 84,613,605 Y478C probably damaging Het
Tdrd12 G T 7: 35,524,057 C67* probably null Het
Tead2 G A 7: 45,218,081 G78D probably damaging Het
Tfpi2 A T 6: 3,963,849 N194K probably damaging Het
Timd2 A G 11: 46,677,200 probably null Het
Tmem270 T C 5: 134,901,703 T235A probably benign Het
Tnrc18 T C 5: 142,788,402 D224G Het
Tsga10 G T 1: 37,801,878 Q416K probably benign Het
Ulk1 C A 5: 110,787,665 L911F probably damaging Het
Usp8 T C 2: 126,742,571 S567P probably benign Het
Zdhhc3 A C 9: 123,089,078 C129G probably damaging Het
Other mutations in Slc6a15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Slc6a15 APN 10 103389141 missense probably benign
IGL01320:Slc6a15 APN 10 103404745 missense probably benign 0.00
IGL01924:Slc6a15 APN 10 103404825 splice site probably null
IGL02066:Slc6a15 APN 10 103416658 missense probably damaging 0.98
IGL02164:Slc6a15 APN 10 103418222 missense probably benign 0.01
IGL02551:Slc6a15 APN 10 103404275 splice site probably benign
IGL02744:Slc6a15 APN 10 103418033 missense probably benign 0.03
R0028:Slc6a15 UTSW 10 103416680 missense probably benign 0.00
R0143:Slc6a15 UTSW 10 103418068 missense probably benign 0.02
R0158:Slc6a15 UTSW 10 103389347 splice site probably benign
R0165:Slc6a15 UTSW 10 103409809 missense probably null 0.04
R0349:Slc6a15 UTSW 10 103418225 missense probably benign 0.06
R0383:Slc6a15 UTSW 10 103418053 missense probably damaging 1.00
R0614:Slc6a15 UTSW 10 103404352 nonsense probably null
R0784:Slc6a15 UTSW 10 103416800 splice site probably benign
R0944:Slc6a15 UTSW 10 103409796 missense probably benign 0.01
R1795:Slc6a15 UTSW 10 103400260 missense probably benign
R1882:Slc6a15 UTSW 10 103395064 missense probably benign 0.20
R2061:Slc6a15 UTSW 10 103409734 missense probably benign 0.20
R2156:Slc6a15 UTSW 10 103393408 missense probably damaging 1.00
R2358:Slc6a15 UTSW 10 103416785 missense probably benign 0.00
R2849:Slc6a15 UTSW 10 103404691 missense probably benign 0.01
R2921:Slc6a15 UTSW 10 103418387 missense probably damaging 0.99
R3709:Slc6a15 UTSW 10 103393414 missense probably benign 0.00
R4532:Slc6a15 UTSW 10 103409787 missense possibly damaging 0.69
R4825:Slc6a15 UTSW 10 103418060 missense probably benign 0.05
R4909:Slc6a15 UTSW 10 103404414 missense probably damaging 1.00
R5112:Slc6a15 UTSW 10 103389226 missense probably benign
R5320:Slc6a15 UTSW 10 103408206 missense probably damaging 1.00
R5364:Slc6a15 UTSW 10 103393508 missense probably damaging 0.99
R6305:Slc6a15 UTSW 10 103389170 missense probably benign 0.31
R6348:Slc6a15 UTSW 10 103404367 missense probably damaging 1.00
R6729:Slc6a15 UTSW 10 103393914 missense probably damaging 0.99
R6781:Slc6a15 UTSW 10 103395067 missense probably damaging 0.99
R7409:Slc6a15 UTSW 10 103408302 missense probably benign
R7549:Slc6a15 UTSW 10 103389137 missense probably benign
R7660:Slc6a15 UTSW 10 103393380 splice site probably null
R7839:Slc6a15 UTSW 10 103404799 missense probably benign
R7948:Slc6a15 UTSW 10 103404295 missense possibly damaging 0.95
R8278:Slc6a15 UTSW 10 103394029 critical splice donor site probably null
R8685:Slc6a15 UTSW 10 103409695 missense possibly damaging 0.68
R8712:Slc6a15 UTSW 10 103389251 missense probably damaging 1.00
R8719:Slc6a15 UTSW 10 103404315 missense probably damaging 0.99
R8832:Slc6a15 UTSW 10 103389318 missense probably damaging 1.00
R8940:Slc6a15 UTSW 10 103393496 missense probably damaging 1.00
R8978:Slc6a15 UTSW 10 103395092 nonsense probably null
R9050:Slc6a15 UTSW 10 103416655 missense possibly damaging 0.88
R9113:Slc6a15 UTSW 10 103400279 missense probably damaging 1.00
R9242:Slc6a15 UTSW 10 103393545 nonsense probably null
R9493:Slc6a15 UTSW 10 103393416 missense probably benign 0.35
R9529:Slc6a15 UTSW 10 103404722 missense probably benign 0.14
R9532:Slc6a15 UTSW 10 103404472 missense probably damaging 0.98
RF013:Slc6a15 UTSW 10 103400216 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTCAAGGGTGTCTTTAAG -3'
(R):5'- CCCTAGCTTTGTAATGGAATTCAC -3'

Sequencing Primer
(F):5'- TCCTGTCCAACGAAGACT -3'
(R):5'- ATACAGGATTGCCCTTTACGGAG -3'
Posted On 2020-09-02