Incidental Mutation 'R8379:Rnf17'
ID646886
Institutional Source Beutler Lab
Gene Symbol Rnf17
Ensembl Gene ENSMUSG00000000365
Gene Namering finger protein 17
SynonymsMMIP-2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.384) question?
Stock #R8379 (G1)
Quality Score217.468
Status Not validated
Chromosome14
Chromosomal Location56402581-56525032 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TG to T at 56424542 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000093469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095793] [ENSMUST00000223627]
Predicted Effect probably null
Transcript: ENSMUST00000095793
SMART Domains Protein: ENSMUSP00000093469
Gene: ENSMUSG00000000365

DomainStartEndE-ValueType
Blast:RING 9 72 2e-15 BLAST
low complexity region 398 405 N/A INTRINSIC
Pfam:TUDOR 440 522 8.2e-8 PFAM
TUDOR 750 807 4.32e-12 SMART
low complexity region 824 836 N/A INTRINSIC
Blast:TUDOR 850 882 1e-8 BLAST
low complexity region 959 970 N/A INTRINSIC
TUDOR 984 1042 1.29e-1 SMART
low complexity region 1128 1139 N/A INTRINSIC
TUDOR 1245 1301 7.7e-9 SMART
low complexity region 1416 1430 N/A INTRINSIC
TUDOR 1495 1554 1e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000223627
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a testis-specific protein containing a RING finger domain. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display male infertility, azoospermia, arrest of spermatogenesis, and small testis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aipl1 T C 11: 72,029,300 D314G probably benign Het
Ankrd12 T G 17: 65,983,944 E1498A probably benign Het
Appl1 A T 14: 26,925,415 probably null Het
Auh A G 13: 52,909,313 *116R probably null Het
Ccdc7a T A 8: 128,964,936 H402L probably benign Het
Ccr4 T C 9: 114,492,167 T277A probably benign Het
Col18a1 C T 10: 77,053,238 V1302I probably benign Het
Csnk1a1 T C 18: 61,555,854 I35T probably benign Het
Csnk1e T C 15: 79,420,682 R374G possibly damaging Het
Ddx11 A G 17: 66,130,025 R105G probably benign Het
Denr C A 5: 123,927,061 T159K possibly damaging Het
Dmp1 C A 5: 104,211,705 Y82* probably null Het
Dok3 A G 13: 55,524,020 V246A probably benign Het
Endov A C 11: 119,491,897 K57Q possibly damaging Het
Fam160a2 T C 7: 105,385,135 N430D possibly damaging Het
Fam83a A G 15: 58,009,800 T342A probably benign Het
Fbln1 G A 15: 85,232,572 C275Y probably damaging Het
Foxi1 A G 11: 34,207,530 I165T possibly damaging Het
Gm14496 A T 2: 182,000,482 I649F probably damaging Het
Gm9268 C T 7: 43,047,846 P776S probably damaging Het
Grin2b A G 6: 135,922,969 S305P probably damaging Het
Grm1 G A 10: 10,689,135 T1143M possibly damaging Het
Ifi202b C A 1: 173,974,732 probably null Het
Klhl32 A T 4: 24,629,194 D491E probably damaging Het
Klk1b1 C T 7: 43,970,343 R109C possibly damaging Het
Krt13 A G 11: 100,118,880 L358P probably damaging Het
Limk2 G A 11: 3,371,162 probably benign Het
Mdn1 A G 4: 32,756,453 D4720G probably null Het
Mkln1 T A 6: 31,458,965 Y286* probably null Het
Muc6 C A 7: 141,644,312 E1143* probably null Het
Myh15 A G 16: 49,081,188 I242M probably benign Het
Noc4l T G 5: 110,650,962 K241Q probably damaging Het
Nup88 C A 11: 70,969,781 L57F possibly damaging Het
Obsl1 G T 1: 75,503,857 F374L possibly damaging Het
Olfr612 A G 7: 103,538,976 I86T possibly damaging Het
Orm1 A T 4: 63,346,118 D137V probably damaging Het
Osbpl2 T A 2: 180,137,102 D9E probably damaging Het
P4ha3 G T 7: 100,293,779 D124Y probably damaging Het
Pgap3 TCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAG 11: 98,390,749 probably benign Het
Poteg T C 8: 27,453,326 V208A probably benign Het
Ppfibp1 A G 6: 147,030,345 D963G probably damaging Het
Prdx6 G T 1: 161,251,090 D9E probably benign Het
Prrc2b C A 2: 32,214,654 N1381K probably damaging Het
Ptpn14 T A 1: 189,833,401 V222E possibly damaging Het
Rasal1 C T 5: 120,666,355 R431C probably benign Het
Rexo5 A T 7: 119,834,285 M422L probably benign Het
Robo2 A T 16: 73,933,700 I1008N probably damaging Het
Sidt1 T A 16: 44,286,392 Y225F probably benign Het
Slc6a15 A T 10: 103,389,187 E45D probably benign Het
Spata31d1a T G 13: 59,702,854 M487L probably benign Het
St6galnac1 C A 11: 116,775,499 probably benign Het
Tcp11l2 A G 10: 84,613,605 Y478C probably damaging Het
Tdrd12 G T 7: 35,524,057 C67* probably null Het
Tead2 G A 7: 45,218,081 G78D probably damaging Het
Tfpi2 A T 6: 3,963,849 N194K probably damaging Het
Tmem270 T C 5: 134,901,703 T235A probably benign Het
Tnrc18 T C 5: 142,788,402 D224G Het
Tsga10 G T 1: 37,801,878 Q416K probably benign Het
Ulk1 C A 5: 110,787,665 L911F probably damaging Het
Usp8 T C 2: 126,742,571 S567P probably benign Het
Zdhhc3 A C 9: 123,089,078 C129G probably damaging Het
Other mutations in Rnf17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Rnf17 APN 14 56421082 missense probably damaging 0.99
IGL00717:Rnf17 APN 14 56465750 missense probably benign 0.00
IGL00978:Rnf17 APN 14 56512271 missense probably damaging 1.00
IGL01295:Rnf17 APN 14 56463064 nonsense probably null
IGL01779:Rnf17 APN 14 56462063 missense probably benign 0.06
IGL02132:Rnf17 APN 14 56421166 missense probably benign 0.27
IGL02183:Rnf17 APN 14 56507868 missense probably null 0.99
IGL02387:Rnf17 APN 14 56500587 missense probably damaging 1.00
IGL02422:Rnf17 APN 14 56482135 missense probably damaging 1.00
IGL03081:Rnf17 APN 14 56434371 missense probably benign 0.03
IGL03269:Rnf17 APN 14 56427946 missense possibly damaging 0.74
R0046:Rnf17 UTSW 14 56471373 missense probably damaging 1.00
R0046:Rnf17 UTSW 14 56471373 missense probably damaging 1.00
R0089:Rnf17 UTSW 14 56514106 missense probably damaging 1.00
R0189:Rnf17 UTSW 14 56482193 missense probably null 1.00
R0243:Rnf17 UTSW 14 56482084 missense possibly damaging 0.80
R0245:Rnf17 UTSW 14 56438609 missense probably damaging 0.97
R0486:Rnf17 UTSW 14 56514175 missense probably benign 0.43
R0554:Rnf17 UTSW 14 56522550 missense probably damaging 1.00
R0840:Rnf17 UTSW 14 56475447 missense probably damaging 1.00
R1169:Rnf17 UTSW 14 56514165 missense possibly damaging 0.89
R1170:Rnf17 UTSW 14 56425631 missense probably benign 0.10
R1200:Rnf17 UTSW 14 56467706 missense probably benign 0.44
R1464:Rnf17 UTSW 14 56461911 missense probably damaging 1.00
R1464:Rnf17 UTSW 14 56461911 missense probably damaging 1.00
R1472:Rnf17 UTSW 14 56427979 missense probably damaging 1.00
R1512:Rnf17 UTSW 14 56467786 missense probably benign 0.01
R1605:Rnf17 UTSW 14 56493365 missense probably damaging 1.00
R1778:Rnf17 UTSW 14 56522399 missense probably damaging 0.99
R1791:Rnf17 UTSW 14 56504007 nonsense probably null
R2015:Rnf17 UTSW 14 56486969 missense probably benign 0.00
R2023:Rnf17 UTSW 14 56431579 missense possibly damaging 0.59
R2086:Rnf17 UTSW 14 56483380 missense probably damaging 0.98
R2130:Rnf17 UTSW 14 56493354 missense probably damaging 1.00
R2309:Rnf17 UTSW 14 56505982 missense possibly damaging 0.95
R3003:Rnf17 UTSW 14 56500547 missense probably damaging 1.00
R3611:Rnf17 UTSW 14 56467740 missense probably benign 0.43
R3847:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3848:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3849:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3850:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3872:Rnf17 UTSW 14 56475413 missense possibly damaging 0.89
R3874:Rnf17 UTSW 14 56475413 missense possibly damaging 0.89
R4021:Rnf17 UTSW 14 56460001 missense probably damaging 0.98
R4022:Rnf17 UTSW 14 56460001 missense probably damaging 0.98
R4790:Rnf17 UTSW 14 56434355 missense probably damaging 1.00
R4951:Rnf17 UTSW 14 56522391 missense probably benign 0.02
R5068:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5069:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5070:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5518:Rnf17 UTSW 14 56482133 missense probably damaging 1.00
R5628:Rnf17 UTSW 14 56486952 splice site probably null
R5712:Rnf17 UTSW 14 56471399 missense probably benign 0.19
R5747:Rnf17 UTSW 14 56465819 critical splice donor site probably null
R5869:Rnf17 UTSW 14 56505988 missense possibly damaging 0.94
R6336:Rnf17 UTSW 14 56421169 splice site probably null
R6626:Rnf17 UTSW 14 56427924 missense possibly damaging 0.92
R6639:Rnf17 UTSW 14 56438743 missense probably benign 0.01
R6675:Rnf17 UTSW 14 56459975 missense probably damaging 1.00
R6731:Rnf17 UTSW 14 56524350 missense possibly damaging 0.93
R7062:Rnf17 UTSW 14 56465654 missense probably benign 0.00
R7103:Rnf17 UTSW 14 56471306 missense possibly damaging 0.63
R7144:Rnf17 UTSW 14 56512332 splice site probably null
R7527:Rnf17 UTSW 14 56516438 missense probably damaging 1.00
R7664:Rnf17 UTSW 14 56438878 missense probably damaging 1.00
R7754:Rnf17 UTSW 14 56462072 critical splice donor site probably null
R7772:Rnf17 UTSW 14 56477687 missense probably benign 0.27
R8092:Rnf17 UTSW 14 56487022 missense probably benign 0.00
R8150:Rnf17 UTSW 14 56421136 missense probably benign 0.19
R8203:Rnf17 UTSW 14 56467722 missense probably benign 0.17
R8320:Rnf17 UTSW 14 56424542 frame shift probably null
R8321:Rnf17 UTSW 14 56424542 frame shift probably null
R8380:Rnf17 UTSW 14 56424542 frame shift probably null
R8381:Rnf17 UTSW 14 56424542 frame shift probably null
R8382:Rnf17 UTSW 14 56424542 frame shift probably null
R8383:Rnf17 UTSW 14 56424542 frame shift probably null
Z1177:Rnf17 UTSW 14 56467706 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- AGCTCCTTAACTATCGCAGC -3'
(R):5'- CTCATACTCAGAAATCCGCCTG -3'

Sequencing Primer
(F):5'- AAAGTGCTTATTTGTATGCAGGAG -3'
(R):5'- TCCCGAGTGCTGGGATCAAAG -3'
Posted On2020-09-02