Incidental Mutation 'R8381:Smok3c'
ID646941
Institutional Source Beutler Lab
Gene Symbol Smok3c
Ensembl Gene ENSMUSG00000075598
Gene Namesperm motility kinase 3C
SynonymsEG622486
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.608) question?
Stock #R8381 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location138053194-138066537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 138065562 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 437 (T437I)
Ref Sequence ENSEMBL: ENSMUSP00000141020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110967] [ENSMUST00000178402]
Predicted Effect probably benign
Transcript: ENSMUST00000110967
AA Change: T437I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141020
Gene: ENSMUSG00000075598
AA Change: T437I

DomainStartEndE-ValueType
S_TKc 28 276 2.88e-97 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178402
AA Change: T437I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140749
Gene: ENSMUSG00000075598
AA Change: T437I

DomainStartEndE-ValueType
S_TKc 28 276 2.88e-97 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik C T 3: 138,173,521 probably null Het
4931417E11Rik A T 6: 73,468,912 V218E probably damaging Het
AA792892 C T 5: 94,384,022 T255I probably damaging Het
Actrt3 A G 3: 30,597,836 *370R probably null Het
Adam34 A G 8: 43,651,810 I266T possibly damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Celsr2 T C 3: 108,395,636 N2507S probably damaging Het
E2f8 T C 7: 48,877,962 D144G probably damaging Het
Eif4enif1 T C 11: 3,227,470 S346P probably damaging Het
Fbln5 A G 12: 101,761,855 F270S probably benign Het
Fnip2 T A 3: 79,465,693 D1026V probably damaging Het
Fubp3 G A 2: 31,592,497 probably null Het
Gjb6 T C 14: 57,124,462 E114G probably benign Het
Gpr160 A G 3: 30,895,781 M1V probably null Het
Hey2 A G 10: 30,833,990 S256P probably damaging Het
Hnrnpll A T 17: 80,030,491 H590Q probably damaging Het
Ice2 T A 9: 69,410,171 H192Q probably damaging Het
Ighv1-20 T A 12: 114,723,881 Q81L probably benign Het
Ighv5-2 T A 12: 113,578,705 H51L probably benign Het
Kif27 T C 13: 58,291,177 D1190G probably benign Het
Klk1b1 C T 7: 43,970,343 R109C possibly damaging Het
Mettl14 A G 3: 123,374,798 Y198H probably damaging Het
Nlrp6 C T 7: 140,923,841 A620V possibly damaging Het
Obsl1 G T 1: 75,503,857 F374L possibly damaging Het
Olfr1100 T C 2: 86,978,029 I256V probably benign Het
Olfr190 A G 16: 59,074,862 S73P probably damaging Het
Olfr65 T C 7: 103,906,939 F164L Het
Pcbp4 G A 9: 106,461,289 A138T probably damaging Het
Rnf17 TG T 14: 56,424,542 probably null Het
Robo3 T A 9: 37,429,760 D72V probably damaging Het
Slc16a5 A G 11: 115,469,890 S300G probably benign Het
Smg6 C T 11: 74,931,740 R670W probably damaging Het
Stk36 A G 1: 74,633,174 I931V probably benign Het
Syk T C 13: 52,633,049 Y383H probably benign Het
Tacc2 T A 7: 130,624,242 S886T probably benign Het
Top1 A G 2: 160,703,674 M321V probably null Het
Ttc17 A G 2: 94,301,821 L598P probably damaging Het
Xdh T G 17: 73,912,461 I648L probably benign Het
Zfhx4 A C 3: 5,382,616 K1126T probably benign Het
Zfp729b T C 13: 67,591,498 T883A possibly damaging Het
Other mutations in Smok3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4440:Smok3c UTSW 5 138064604 missense possibly damaging 0.93
R4560:Smok3c UTSW 5 138064484 missense probably benign 0.42
R4900:Smok3c UTSW 5 138064551 missense probably damaging 1.00
R4924:Smok3c UTSW 5 138065582 nonsense probably null
R5292:Smok3c UTSW 5 138065184 missense probably damaging 1.00
R5446:Smok3c UTSW 5 138064633 missense probably damaging 1.00
R6111:Smok3c UTSW 5 138065103 missense probably damaging 0.98
R6154:Smok3c UTSW 5 138064485 missense probably benign 0.04
R6225:Smok3c UTSW 5 138065052 missense probably benign 0.15
R6759:Smok3c UTSW 5 138065437 missense probably benign 0.04
R6979:Smok3c UTSW 5 138064725 missense probably benign 0.12
R7127:Smok3c UTSW 5 138064709 missense probably damaging 0.96
R7260:Smok3c UTSW 5 138065623 missense possibly damaging 0.84
R7445:Smok3c UTSW 5 138064495 missense probably damaging 1.00
R7962:Smok3c UTSW 5 138065079 missense probably damaging 0.98
R8160:Smok3c UTSW 5 138065024 missense possibly damaging 0.91
R8223:Smok3c UTSW 5 138065393 missense probably benign 0.00
R8841:Smok3c UTSW 5 138065275 missense probably damaging 0.99
Z1177:Smok3c UTSW 5 138064602 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCTACTACCTGTCTCGGAC -3'
(R):5'- CCCAGGTGAGATGTCTCTTTG -3'

Sequencing Primer
(F):5'- TGAACCCACATGTCCCTGG -3'
(R):5'- CTCTTTGGATGGGATACAGCAAC -3'
Posted On2020-09-02