Incidental Mutation 'R8381:Slc16a5'
ID646956
Institutional Source Beutler Lab
Gene Symbol Slc16a5
Ensembl Gene ENSMUSG00000045775
Gene Namesolute carrier family 16 (monocarboxylic acid transporters), member 5
SynonymsMCT5, A130015N09Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R8381 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location115462474-115474398 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115469890 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 300 (S300G)
Ref Sequence ENSEMBL: ENSMUSP00000090102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092445] [ENSMUST00000106532] [ENSMUST00000153466]
Predicted Effect probably benign
Transcript: ENSMUST00000092445
AA Change: S300G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090102
Gene: ENSMUSG00000045775
AA Change: S300G

DomainStartEndE-ValueType
Pfam:MFS_1 15 303 5.9e-31 PFAM
Pfam:MFS_1 302 459 6.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106532
SMART Domains Protein: ENSMUSP00000102142
Gene: ENSMUSG00000045775

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153466
SMART Domains Protein: ENSMUSP00000117727
Gene: ENSMUSG00000045775

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
transmembrane domain 85 107 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the monocarboxylate transporter family and the major facilitator superfamily. The encoded protein is localized to the cell membrane and acts as a proton-linked transporter of bumetanide. Transport by the encoded protein is inhibited by four loop diuretics, nateglinide, thiazides, probenecid, and glibenclamide. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik C T 3: 138,173,521 probably null Het
4931417E11Rik A T 6: 73,468,912 V218E probably damaging Het
AA792892 C T 5: 94,384,022 T255I probably damaging Het
Actrt3 A G 3: 30,597,836 *370R probably null Het
Adam34 A G 8: 43,651,810 I266T possibly damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Celsr2 T C 3: 108,395,636 N2507S probably damaging Het
E2f8 T C 7: 48,877,962 D144G probably damaging Het
Eif4enif1 T C 11: 3,227,470 S346P probably damaging Het
Fbln5 A G 12: 101,761,855 F270S probably benign Het
Fnip2 T A 3: 79,465,693 D1026V probably damaging Het
Fubp3 G A 2: 31,592,497 probably null Het
Gjb6 T C 14: 57,124,462 E114G probably benign Het
Gpr160 A G 3: 30,895,781 M1V probably null Het
Hey2 A G 10: 30,833,990 S256P probably damaging Het
Hnrnpll A T 17: 80,030,491 H590Q probably damaging Het
Ice2 T A 9: 69,410,171 H192Q probably damaging Het
Ighv1-20 T A 12: 114,723,881 Q81L probably benign Het
Ighv5-2 T A 12: 113,578,705 H51L probably benign Het
Kif27 T C 13: 58,291,177 D1190G probably benign Het
Klk1b1 C T 7: 43,970,343 R109C possibly damaging Het
Mettl14 A G 3: 123,374,798 Y198H probably damaging Het
Nlrp6 C T 7: 140,923,841 A620V possibly damaging Het
Obsl1 G T 1: 75,503,857 F374L possibly damaging Het
Olfr1100 T C 2: 86,978,029 I256V probably benign Het
Olfr190 A G 16: 59,074,862 S73P probably damaging Het
Olfr65 T C 7: 103,906,939 F164L Het
Pcbp4 G A 9: 106,461,289 A138T probably damaging Het
Rnf17 TG T 14: 56,424,542 probably null Het
Robo3 T A 9: 37,429,760 D72V probably damaging Het
Smg6 C T 11: 74,931,740 R670W probably damaging Het
Smok3c C T 5: 138,065,562 T437I probably benign Het
Stk36 A G 1: 74,633,174 I931V probably benign Het
Syk T C 13: 52,633,049 Y383H probably benign Het
Tacc2 T A 7: 130,624,242 S886T probably benign Het
Top1 A G 2: 160,703,674 M321V probably null Het
Ttc17 A G 2: 94,301,821 L598P probably damaging Het
Xdh T G 17: 73,912,461 I648L probably benign Het
Zfhx4 A C 3: 5,382,616 K1126T probably benign Het
Zfp729b T C 13: 67,591,498 T883A possibly damaging Het
Other mutations in Slc16a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01832:Slc16a5 APN 11 115465001 missense probably benign
IGL02190:Slc16a5 APN 11 115462609 start codon destroyed probably null 1.00
IGL02852:Slc16a5 APN 11 115469579 missense probably benign 0.03
IGL02942:Slc16a5 APN 11 115469350 missense possibly damaging 0.50
R0090:Slc16a5 UTSW 11 115464925 missense probably damaging 1.00
R1928:Slc16a5 UTSW 11 115470016 missense probably damaging 0.98
R1930:Slc16a5 UTSW 11 115469368 missense probably damaging 0.99
R1931:Slc16a5 UTSW 11 115469368 missense probably damaging 0.99
R5255:Slc16a5 UTSW 11 115462675 missense probably benign 0.13
R5548:Slc16a5 UTSW 11 115469804 missense probably benign 0.32
R5592:Slc16a5 UTSW 11 115472782 missense probably benign 0.05
R5770:Slc16a5 UTSW 11 115472778 missense possibly damaging 0.70
Z1176:Slc16a5 UTSW 11 115469372 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACATGTGTCTCAACCATTCGG -3'
(R):5'- TCCATTAGAACCTGGAAGACGAG -3'

Sequencing Primer
(F):5'- ATCCTTCGGCACAATATGGG -3'
(R):5'- TGGAAGACGAGGATCCCAACTC -3'
Posted On2020-09-02