Incidental Mutation 'R8381:Fbln5'
ID646957
Institutional Source Beutler Lab
Gene Symbol Fbln5
Ensembl Gene ENSMUSG00000021186
Gene Namefibulin 5
SynonymsEVEC
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R8381 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location101746565-101819055 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101761855 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 270 (F270S)
Ref Sequence ENSEMBL: ENSMUSP00000021603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021603] [ENSMUST00000222587]
Predicted Effect probably benign
Transcript: ENSMUST00000021603
AA Change: F270S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021603
Gene: ENSMUSG00000021186
AA Change: F270S

DomainStartEndE-ValueType
EGF_like 42 86 4.71e-1 SMART
EGF_CA 127 167 4.81e-8 SMART
EGF_CA 168 206 2.31e-10 SMART
EGF_CA 207 246 5.31e-10 SMART
EGF_CA 247 287 2.22e-12 SMART
EGF_like 288 333 8.14e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000222587
AA Change: F283S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secreted, extracellular matrix protein containing an Arg-Gly-Asp (RGD) motif and calcium-binding EGF-like domains. It promotes adhesion of endothelial cells through interaction of integrins and the RGD motif. It is prominently expressed in developing arteries but less so in adult vessels. However, its expression is reinduced in balloon-injured vessels and atherosclerotic lesions, notably in intimal vascular smooth muscle cells and endothelial cells. Therefore, the protein encoded by this gene may play a role in vascular development and remodeling. Defects in this gene are a cause of autosomal dominant cutis laxa, autosomal recessive cutis laxa type I (CL type I), and age-related macular degeneration type 3 (ARMD3). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this locus impairs elastic fiber development. Mutant mice exhibit loose skin, lung abnormalities leading to emphysema, and cardiovascular defects affecting the aorta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik C T 3: 138,173,521 probably null Het
4931417E11Rik A T 6: 73,468,912 V218E probably damaging Het
AA792892 C T 5: 94,384,022 T255I probably damaging Het
Actrt3 A G 3: 30,597,836 *370R probably null Het
Adam34 A G 8: 43,651,810 I266T possibly damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Celsr2 T C 3: 108,395,636 N2507S probably damaging Het
E2f8 T C 7: 48,877,962 D144G probably damaging Het
Eif4enif1 T C 11: 3,227,470 S346P probably damaging Het
Fnip2 T A 3: 79,465,693 D1026V probably damaging Het
Fubp3 G A 2: 31,592,497 probably null Het
Gjb6 T C 14: 57,124,462 E114G probably benign Het
Gpr160 A G 3: 30,895,781 M1V probably null Het
Hey2 A G 10: 30,833,990 S256P probably damaging Het
Hnrnpll A T 17: 80,030,491 H590Q probably damaging Het
Ice2 T A 9: 69,410,171 H192Q probably damaging Het
Ighv1-20 T A 12: 114,723,881 Q81L probably benign Het
Ighv5-2 T A 12: 113,578,705 H51L probably benign Het
Kif27 T C 13: 58,291,177 D1190G probably benign Het
Klk1b1 C T 7: 43,970,343 R109C possibly damaging Het
Mettl14 A G 3: 123,374,798 Y198H probably damaging Het
Nlrp6 C T 7: 140,923,841 A620V possibly damaging Het
Obsl1 G T 1: 75,503,857 F374L possibly damaging Het
Olfr1100 T C 2: 86,978,029 I256V probably benign Het
Olfr190 A G 16: 59,074,862 S73P probably damaging Het
Olfr65 T C 7: 103,906,939 F164L Het
Pcbp4 G A 9: 106,461,289 A138T probably damaging Het
Rnf17 TG T 14: 56,424,542 probably null Het
Robo3 T A 9: 37,429,760 D72V probably damaging Het
Slc16a5 A G 11: 115,469,890 S300G probably benign Het
Smg6 C T 11: 74,931,740 R670W probably damaging Het
Smok3c C T 5: 138,065,562 T437I probably benign Het
Stk36 A G 1: 74,633,174 I931V probably benign Het
Syk T C 13: 52,633,049 Y383H probably benign Het
Tacc2 T A 7: 130,624,242 S886T probably benign Het
Top1 A G 2: 160,703,674 M321V probably null Het
Ttc17 A G 2: 94,301,821 L598P probably damaging Het
Xdh T G 17: 73,912,461 I648L probably benign Het
Zfhx4 A C 3: 5,382,616 K1126T probably benign Het
Zfp729b T C 13: 67,591,498 T883A possibly damaging Het
Other mutations in Fbln5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Fbln5 APN 12 101809916 missense probably damaging 0.98
IGL01357:Fbln5 APN 12 101750887 missense probably damaging 1.00
IGL01860:Fbln5 APN 12 101809869 missense probably damaging 1.00
IGL02567:Fbln5 APN 12 101761800 critical splice donor site probably null
BB004:Fbln5 UTSW 12 101818388 start gained probably benign
BB014:Fbln5 UTSW 12 101818388 start gained probably benign
R0368:Fbln5 UTSW 12 101809714 critical splice donor site probably null
R1080:Fbln5 UTSW 12 101750872 missense possibly damaging 0.90
R1606:Fbln5 UTSW 12 101765198 missense probably benign 0.04
R2107:Fbln5 UTSW 12 101771269 missense probably damaging 1.00
R2138:Fbln5 UTSW 12 101761920 missense probably benign 0.32
R3694:Fbln5 UTSW 12 101765252 missense probably benign 0.00
R3918:Fbln5 UTSW 12 101750791 missense probably damaging 1.00
R4166:Fbln5 UTSW 12 101757359 missense probably damaging 1.00
R4626:Fbln5 UTSW 12 101760827 missense probably damaging 1.00
R5004:Fbln5 UTSW 12 101760821 missense probably damaging 0.99
R5264:Fbln5 UTSW 12 101757444 missense possibly damaging 0.94
R5364:Fbln5 UTSW 12 101771364 missense probably damaging 0.98
R5767:Fbln5 UTSW 12 101765209 missense probably damaging 0.97
R5889:Fbln5 UTSW 12 101765226 missense probably damaging 1.00
R5914:Fbln5 UTSW 12 101760743 missense possibly damaging 0.78
R6427:Fbln5 UTSW 12 101761822 missense possibly damaging 0.84
R7079:Fbln5 UTSW 12 101757408 missense probably damaging 1.00
R7343:Fbln5 UTSW 12 101760816 missense probably damaging 1.00
R7803:Fbln5 UTSW 12 101761818 missense probably damaging 1.00
R7927:Fbln5 UTSW 12 101818388 start gained probably benign
R8190:Fbln5 UTSW 12 101757296 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTGCCACCTACCTCTACAG -3'
(R):5'- AAGAAGTAAGTTGGCAACCTCG -3'

Sequencing Primer
(F):5'- CTCTACAGAGGTCATTGTACAGAC -3'
(R):5'- AGTAAGTTGGCAACCTCGTAGCC -3'
Posted On2020-09-02