Mutagenetix > Incidental Mutation

Incidental Mutation 'R0041:Rpl7a'

64696

Institutional Source

Beutler Lab

Gene Symbol

Rpl7a

Ensembl Gene

ENSMUSG00000062647

Gene Name

ribosomal protein L7A

Synonyms

surfeit 3, Surf-3

MMRRC Submission

038335-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.957) question?

Stock #

R0041 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

26800776-26803330 bp(+) (GRCm39)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 26801563 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000015017 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015017] [ENSMUST00000015920] [ENSMUST00000015934] [ENSMUST00000102898] [ENSMUST00000147110] [ENSMUST00000133513] [ENSMUST00000129682] [ENSMUST00000102899] [ENSMUST00000139815] [ENSMUST00000167661]

AlphaFold

P12970

Predicted Effect

probably null
Transcript: ENSMUST00000015017

SMART Domains

Protein: ENSMUSP00000015017
Gene: ENSMUSG00000014873

Domain	Start	End	E-Value	Type
Pfam:SURF2	4	251	5.7e-98	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000015920

SMART Domains

Protein: ENSMUSP00000015920
Gene: ENSMUSG00000015776

Domain	Start	End	E-Value	Type
Pfam:Med22	20	125	5.7e-40	PFAM
low complexity region	127	141	N/A	INTRINSIC
low complexity region	156	174	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000015934

SMART Domains

Protein: ENSMUSP00000015934
Gene: ENSMUSG00000015790

Domain	Start	End	E-Value	Type
low complexity region	8	21	N/A	INTRINSIC
low complexity region	83	98	N/A	INTRINSIC
Pfam:SURF1	106	321	6.7e-50	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000082895

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083324

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083361

Predicted Effect

probably benign
Transcript: ENSMUST00000102898
AA Change: Q85R

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000099962
Gene: ENSMUSG00000062647
AA Change: Q85R

Domain	Start	End	E-Value	Type
low complexity region	2	28	N/A	INTRINSIC
Pfam:Ribosomal_L7Ae	122	216	1.2e-25	PFAM
low complexity region	251	262	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142967

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143678

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129673

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136269

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126947

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137376

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128665

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147143

Predicted Effect

probably benign
Transcript: ENSMUST00000147110

SMART Domains

Protein: ENSMUSP00000141238
Gene: ENSMUSG00000015790

Domain	Start	End	E-Value	Type
low complexity region	8	23	N/A	INTRINSIC
Pfam:SURF1	30	240	5.1e-56	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000129822

Predicted Effect

probably benign
Transcript: ENSMUST00000133513

SMART Domains

Protein: ENSMUSP00000141317
Gene: ENSMUSG00000015790

Domain	Start	End	E-Value	Type
low complexity region	8	23	N/A	INTRINSIC
Pfam:SURF1	30	63	7.2e-10	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000129682

Predicted Effect

probably benign
Transcript: ENSMUST00000102899

SMART Domains

Protein: ENSMUSP00000099963
Gene: ENSMUSG00000015776

Domain	Start	End	E-Value	Type
Pfam:Med22	14	130	5.6e-39	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000139815

SMART Domains

Protein: ENSMUSP00000116442
Gene: ENSMUSG00000015776

Domain	Start	End	E-Value	Type
Pfam:Med22	14	72	3e-14	PFAM
Pfam:Med22	96	166	2.7e-22	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149339

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150776

Predicted Effect

probably benign
Transcript: ENSMUST00000167661

SMART Domains

Protein: ENSMUSP00000128488
Gene: ENSMUSG00000015790

Domain	Start	End	E-Value	Type
low complexity region	51	66	N/A	INTRINSIC
Pfam:SURF1	73	290	5.9e-64	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000183520

Meta Mutation Damage Score

0.1489

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.8%
20x: 96.3%

Validation Efficiency

97% (58/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytoplasmic ribosomes, organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L7AE family of ribosomal proteins. It can interact with a subclass of nuclear hormone receptors, including thyroid hormone receptor, and inhibit their ability to transactivate by preventing their binding to their DNA response elements. This gene is included in the surfeit gene cluster, a group of very tightly linked genes that do not share sequence similarity. It is co-transcribed with the U24, U36a, U36b, and U36c small nucleolar RNA genes, which are located in its second, fifth, fourth, and sixth introns, respectively. This gene rearranges with the trk proto-oncogene to form the chimeric oncogene trk-2h, which encodes an oncoprotein consisting of the N terminus of ribosomal protein L7a fused to the receptor tyrosine kinase domain of trk. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts13	A	G	2: 26,873,986 (GRCm39)	R412G	probably damaging	Het
Adamts3	T	A	5: 89,832,326 (GRCm39)	N927Y	probably benign	Het
Adgra3	A	G	5: 50,117,901 (GRCm39)	Y1216H	probably benign	Het
Agpat3	C	A	10: 78,123,881 (GRCm39)		probably benign	Het
AI182371	T	A	2: 34,975,733 (GRCm39)	Q277L	possibly damaging	Het
Arhgef15	A	T	11: 68,845,342 (GRCm39)	L170Q	possibly damaging	Het
Avpi1	C	A	19: 42,112,223 (GRCm39)	E112*	probably null	Het
Braf	C	T	6: 39,617,413 (GRCm39)	A534T	probably damaging	Het
Bspry	G	C	4: 62,404,791 (GRCm39)	A196P	probably damaging	Het
Cacna1c	T	A	6: 118,570,988 (GRCm39)	L2095F	probably damaging	Het
Cdhr2	A	T	13: 54,874,651 (GRCm39)	S908C	probably damaging	Het
Cntnap5c	C	A	17: 58,183,464 (GRCm39)	Q57K	probably benign	Het
Dtna	C	T	18: 23,779,932 (GRCm39)		probably benign	Het
Dynap	A	G	18: 70,375,105 (GRCm39)	S37P	possibly damaging	Het
Efna5	A	T	17: 62,914,467 (GRCm39)		probably benign	Het
Fancm	T	A	12: 65,153,217 (GRCm39)	C1224*	probably null	Het
Fbxw16	T	A	9: 109,277,232 (GRCm39)	S37C	probably damaging	Het
Galnt4	A	G	10: 98,944,374 (GRCm39)	Y33C	probably benign	Het
Kcnk2	G	T	1: 189,027,888 (GRCm39)	N122K	probably benign	Het
Krt71	C	A	15: 101,647,753 (GRCm39)	E222D	probably damaging	Het
Ltf	T	A	9: 110,858,636 (GRCm39)	D461E	possibly damaging	Het
Mapk4	A	T	18: 74,068,109 (GRCm39)	L274Q	probably damaging	Het
Mbd6	A	G	10: 127,122,741 (GRCm39)	C103R	probably damaging	Het
Nbeal1	A	G	1: 60,321,030 (GRCm39)	N2047S	probably benign	Het
Nefh	C	T	11: 4,895,184 (GRCm39)	S335N	possibly damaging	Het
Obscn	G	T	11: 58,934,803 (GRCm39)	H4715N	probably damaging	Het
Olfml1	A	T	7: 107,189,393 (GRCm39)	I153L	possibly damaging	Het
Or6d13	G	A	6: 116,518,295 (GRCm39)	V294I	possibly damaging	Het
Or8g34	T	A	9: 39,372,772 (GRCm39)	F12Y	probably benign	Het
Pck1	A	G	2: 172,997,003 (GRCm39)	E215G	probably benign	Het
Peg12	T	A	7: 62,113,308 (GRCm39)	E263V	unknown	Het
Phkg1	T	A	5: 129,903,103 (GRCm39)	T15S	probably benign	Het
Plekhg1	T	A	10: 3,914,076 (GRCm39)	L1120*	probably null	Het
Prss59	A	T	6: 40,903,042 (GRCm39)	L110*	probably null	Het
Rlf	T	A	4: 121,007,126 (GRCm39)	H618L	probably damaging	Het
Rnf112	T	A	11: 61,343,181 (GRCm39)	R165W	probably damaging	Het
Rnf213	A	G	11: 119,293,401 (GRCm39)	T51A	probably benign	Het
Rnf220	A	G	4: 117,130,481 (GRCm39)	L293P	probably damaging	Het
Rock1	T	C	18: 10,140,240 (GRCm39)	D117G	probably damaging	Het
Rp1	A	G	1: 4,414,851 (GRCm39)	V2087A	probably benign	Het
Serpinb6d	A	G	13: 33,851,615 (GRCm39)	D124G	probably damaging	Het
Skor1	T	G	9: 63,053,133 (GRCm39)	T279P	probably damaging	Het
Son	A	T	16: 91,456,221 (GRCm39)	E1656V	probably damaging	Het
Swap70	A	G	7: 109,878,562 (GRCm39)	K511E	probably benign	Het
Treh	T	C	9: 44,594,910 (GRCm39)	V262A	probably benign	Het
Trpm4	A	G	7: 44,954,370 (GRCm39)		probably null	Het
Ugt8a	T	C	3: 125,708,739 (GRCm39)	I124V	probably benign	Het
Wdr53	T	C	16: 32,075,473 (GRCm39)	V226A	probably damaging	Het
Wdr64	G	A	1: 175,554,037 (GRCm39)	W189*	probably null	Het

Other mutations in Rpl7a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Rpl7a	APN	2	26,801,067 (GRCm39)	unclassified	probably benign
IGL00951:Rpl7a	APN	2	26,802,441 (GRCm39)	missense	possibly damaging	0.47
R1491:Rpl7a	UTSW	2	26,801,127 (GRCm39)	missense	probably damaging	0.98
R2102:Rpl7a	UTSW	2	26,801,473 (GRCm39)	missense	possibly damaging	0.93
R6601:Rpl7a	UTSW	2	26,801,536 (GRCm39)	missense	probably benign	0.36
R7378:Rpl7a	UTSW	2	26,802,019 (GRCm39)	splice site	probably null
R8926:Rpl7a	UTSW	2	26,801,557 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTTGACGGGCAATGGACTGAATG -3'
(R):5'- ATTGTGGTACACTGATGAGACGGC -3'

Sequencing Primer
(F):5'- AAGATCGCTGATGCACCG -3'
(R):5'- CGGCAGGAGGTCAACAC -3'

Posted On

2013-08-06