Incidental Mutation 'R8381:Rnf17'
ID646963
Institutional Source Beutler Lab
Gene Symbol Rnf17
Ensembl Gene ENSMUSG00000000365
Gene Namering finger protein 17
SynonymsMMIP-2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.453) question?
Stock #R8381 (G1)
Quality Score217.468
Status Not validated
Chromosome14
Chromosomal Location56402581-56525032 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TG to T at 56424542 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000093469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095793] [ENSMUST00000223627]
Predicted Effect probably null
Transcript: ENSMUST00000095793
SMART Domains Protein: ENSMUSP00000093469
Gene: ENSMUSG00000000365

DomainStartEndE-ValueType
Blast:RING 9 72 2e-15 BLAST
low complexity region 398 405 N/A INTRINSIC
Pfam:TUDOR 440 522 8.2e-8 PFAM
TUDOR 750 807 4.32e-12 SMART
low complexity region 824 836 N/A INTRINSIC
Blast:TUDOR 850 882 1e-8 BLAST
low complexity region 959 970 N/A INTRINSIC
TUDOR 984 1042 1.29e-1 SMART
low complexity region 1128 1139 N/A INTRINSIC
TUDOR 1245 1301 7.7e-9 SMART
low complexity region 1416 1430 N/A INTRINSIC
TUDOR 1495 1554 1e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000223627
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a testis-specific protein containing a RING finger domain. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display male infertility, azoospermia, arrest of spermatogenesis, and small testis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik C T 3: 138,173,521 probably null Het
4931417E11Rik A T 6: 73,468,912 V218E probably damaging Het
AA792892 C T 5: 94,384,022 T255I probably damaging Het
Actrt3 A G 3: 30,597,836 *370R probably null Het
Adam34 A G 8: 43,651,810 I266T possibly damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Celsr2 T C 3: 108,395,636 N2507S probably damaging Het
E2f8 T C 7: 48,877,962 D144G probably damaging Het
Eif4enif1 T C 11: 3,227,470 S346P probably damaging Het
Fbln5 A G 12: 101,761,855 F270S probably benign Het
Fnip2 T A 3: 79,465,693 D1026V probably damaging Het
Fubp3 G A 2: 31,592,497 probably null Het
Gjb6 T C 14: 57,124,462 E114G probably benign Het
Gpr160 A G 3: 30,895,781 M1V probably null Het
Hey2 A G 10: 30,833,990 S256P probably damaging Het
Hnrnpll A T 17: 80,030,491 H590Q probably damaging Het
Ice2 T A 9: 69,410,171 H192Q probably damaging Het
Ighv1-20 T A 12: 114,723,881 Q81L probably benign Het
Ighv5-2 T A 12: 113,578,705 H51L probably benign Het
Kif27 T C 13: 58,291,177 D1190G probably benign Het
Klk1b1 C T 7: 43,970,343 R109C possibly damaging Het
Mettl14 A G 3: 123,374,798 Y198H probably damaging Het
Nlrp6 C T 7: 140,923,841 A620V possibly damaging Het
Obsl1 G T 1: 75,503,857 F374L possibly damaging Het
Olfr1100 T C 2: 86,978,029 I256V probably benign Het
Olfr190 A G 16: 59,074,862 S73P probably damaging Het
Olfr65 T C 7: 103,906,939 F164L Het
Pcbp4 G A 9: 106,461,289 A138T probably damaging Het
Robo3 T A 9: 37,429,760 D72V probably damaging Het
Slc16a5 A G 11: 115,469,890 S300G probably benign Het
Smg6 C T 11: 74,931,740 R670W probably damaging Het
Smok3c C T 5: 138,065,562 T437I probably benign Het
Stk36 A G 1: 74,633,174 I931V probably benign Het
Syk T C 13: 52,633,049 Y383H probably benign Het
Tacc2 T A 7: 130,624,242 S886T probably benign Het
Top1 A G 2: 160,703,674 M321V probably null Het
Ttc17 A G 2: 94,301,821 L598P probably damaging Het
Xdh T G 17: 73,912,461 I648L probably benign Het
Zfhx4 A C 3: 5,382,616 K1126T probably benign Het
Zfp729b T C 13: 67,591,498 T883A possibly damaging Het
Other mutations in Rnf17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Rnf17 APN 14 56421082 missense probably damaging 0.99
IGL00717:Rnf17 APN 14 56465750 missense probably benign 0.00
IGL00978:Rnf17 APN 14 56512271 missense probably damaging 1.00
IGL01295:Rnf17 APN 14 56463064 nonsense probably null
IGL01779:Rnf17 APN 14 56462063 missense probably benign 0.06
IGL02132:Rnf17 APN 14 56421166 missense probably benign 0.27
IGL02183:Rnf17 APN 14 56507868 missense probably null 0.99
IGL02387:Rnf17 APN 14 56500587 missense probably damaging 1.00
IGL02422:Rnf17 APN 14 56482135 missense probably damaging 1.00
IGL03081:Rnf17 APN 14 56434371 missense probably benign 0.03
IGL03269:Rnf17 APN 14 56427946 missense possibly damaging 0.74
R0046:Rnf17 UTSW 14 56471373 missense probably damaging 1.00
R0046:Rnf17 UTSW 14 56471373 missense probably damaging 1.00
R0089:Rnf17 UTSW 14 56514106 missense probably damaging 1.00
R0189:Rnf17 UTSW 14 56482193 missense probably null 1.00
R0243:Rnf17 UTSW 14 56482084 missense possibly damaging 0.80
R0245:Rnf17 UTSW 14 56438609 missense probably damaging 0.97
R0486:Rnf17 UTSW 14 56514175 missense probably benign 0.43
R0554:Rnf17 UTSW 14 56522550 missense probably damaging 1.00
R0840:Rnf17 UTSW 14 56475447 missense probably damaging 1.00
R1169:Rnf17 UTSW 14 56514165 missense possibly damaging 0.89
R1170:Rnf17 UTSW 14 56425631 missense probably benign 0.10
R1200:Rnf17 UTSW 14 56467706 missense probably benign 0.44
R1464:Rnf17 UTSW 14 56461911 missense probably damaging 1.00
R1464:Rnf17 UTSW 14 56461911 missense probably damaging 1.00
R1472:Rnf17 UTSW 14 56427979 missense probably damaging 1.00
R1512:Rnf17 UTSW 14 56467786 missense probably benign 0.01
R1605:Rnf17 UTSW 14 56493365 missense probably damaging 1.00
R1778:Rnf17 UTSW 14 56522399 missense probably damaging 0.99
R1791:Rnf17 UTSW 14 56504007 nonsense probably null
R2015:Rnf17 UTSW 14 56486969 missense probably benign 0.00
R2023:Rnf17 UTSW 14 56431579 missense possibly damaging 0.59
R2086:Rnf17 UTSW 14 56483380 missense probably damaging 0.98
R2130:Rnf17 UTSW 14 56493354 missense probably damaging 1.00
R2309:Rnf17 UTSW 14 56505982 missense possibly damaging 0.95
R3003:Rnf17 UTSW 14 56500547 missense probably damaging 1.00
R3611:Rnf17 UTSW 14 56467740 missense probably benign 0.43
R3847:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3848:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3849:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3850:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3872:Rnf17 UTSW 14 56475413 missense possibly damaging 0.89
R3874:Rnf17 UTSW 14 56475413 missense possibly damaging 0.89
R4021:Rnf17 UTSW 14 56460001 missense probably damaging 0.98
R4022:Rnf17 UTSW 14 56460001 missense probably damaging 0.98
R4790:Rnf17 UTSW 14 56434355 missense probably damaging 1.00
R4951:Rnf17 UTSW 14 56522391 missense probably benign 0.02
R5068:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5069:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5070:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5518:Rnf17 UTSW 14 56482133 missense probably damaging 1.00
R5628:Rnf17 UTSW 14 56486952 splice site probably null
R5712:Rnf17 UTSW 14 56471399 missense probably benign 0.19
R5747:Rnf17 UTSW 14 56465819 critical splice donor site probably null
R5869:Rnf17 UTSW 14 56505988 missense possibly damaging 0.94
R6336:Rnf17 UTSW 14 56421169 splice site probably null
R6626:Rnf17 UTSW 14 56427924 missense possibly damaging 0.92
R6639:Rnf17 UTSW 14 56438743 missense probably benign 0.01
R6675:Rnf17 UTSW 14 56459975 missense probably damaging 1.00
R6731:Rnf17 UTSW 14 56524350 missense possibly damaging 0.93
R7062:Rnf17 UTSW 14 56465654 missense probably benign 0.00
R7103:Rnf17 UTSW 14 56471306 missense possibly damaging 0.63
R7144:Rnf17 UTSW 14 56512332 splice site probably null
R7527:Rnf17 UTSW 14 56516438 missense probably damaging 1.00
R7664:Rnf17 UTSW 14 56438878 missense probably damaging 1.00
R7754:Rnf17 UTSW 14 56462072 critical splice donor site probably null
R7772:Rnf17 UTSW 14 56477687 missense probably benign 0.27
R8092:Rnf17 UTSW 14 56487022 missense probably benign 0.00
R8150:Rnf17 UTSW 14 56421136 missense probably benign 0.19
R8203:Rnf17 UTSW 14 56467722 missense probably benign 0.17
R8320:Rnf17 UTSW 14 56424542 frame shift probably null
R8321:Rnf17 UTSW 14 56424542 frame shift probably null
R8379:Rnf17 UTSW 14 56424542 frame shift probably null
R8380:Rnf17 UTSW 14 56424542 frame shift probably null
R8382:Rnf17 UTSW 14 56424542 frame shift probably null
R8383:Rnf17 UTSW 14 56424542 frame shift probably null
Z1177:Rnf17 UTSW 14 56467706 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GAGCTCCTTAACTATCGCAGC -3'
(R):5'- TACTCAGAAATCCGCCTGC -3'

Sequencing Primer
(F):5'- AAAGTGCTTATTTGTATGCAGGAG -3'
(R):5'- TCCCGAGTGCTGGGATCAAAG -3'
Posted On2020-09-02