Incidental Mutation 'R8382:Olfr1197'
ID646969
Institutional Source Beutler Lab
Gene Symbol Olfr1197
Ensembl Gene ENSMUSG00000075119
Gene Nameolfactory receptor 1197
SynonymsMOR225-10P, GA_x6K02T2Q125-50202854-50201910, MOR225-14
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R8382 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location88726903-88732366 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88729513 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 29 (F29I)
Ref Sequence ENSEMBL: ENSMUSP00000150290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099815] [ENSMUST00000213118]
Predicted Effect probably damaging
Transcript: ENSMUST00000099815
AA Change: F29I

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097403
Gene: ENSMUSG00000075119
AA Change: F29I

DomainStartEndE-ValueType
Pfam:7tm_4 29 302 1.3e-45 PFAM
Pfam:7tm_1 39 285 7.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213118
AA Change: F29I

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.6%
Validation Efficiency 94% (33/35)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,560,682 R689G probably benign Het
Anapc4 T A 5: 52,858,935 probably null Het
Atg9a G A 1: 75,185,698 Q523* probably null Het
C130026I21Rik G A 1: 85,246,950 S288L possibly damaging Het
Cacna1i G A 15: 80,376,816 V1342M probably damaging Het
Ccdc87 A G 19: 4,839,990 D170G possibly damaging Het
Cpsf1 A G 15: 76,600,951 V541A probably benign Het
Depdc5 C T 5: 32,927,898 T687M probably benign Het
Ear6 T C 14: 51,854,113 I39T probably damaging Het
Fam155a T C 8: 9,207,972 E392G probably benign Het
Fcgbp C T 7: 28,117,337 A2408V probably benign Het
Frmd4b G A 6: 97,305,248 T539I probably benign Het
Gif A T 19: 11,749,726 T100S probably benign Het
Gm19410 T A 8: 35,809,148 V1653D probably damaging Het
Gm906 T C 13: 50,247,438 K284R possibly damaging Het
Jade1 A G 3: 41,564,934 probably null Het
Kncn A G 4: 115,886,750 N75S probably benign Het
Lig4 C T 8: 9,972,346 G478D probably damaging Het
Med24 G A 11: 98,717,711 T205I unknown Het
Meiob A G 17: 24,827,939 E179G possibly damaging Het
Olfr907 A T 9: 38,499,292 I208F probably damaging Het
Olfr975 A G 9: 39,950,159 V204A probably benign Het
Pcdh15 T C 10: 74,643,395 V708A probably benign Het
Pclo T A 5: 14,677,066 D1979E unknown Het
Plxnd1 A T 6: 115,972,472 H784Q probably benign Het
Prim1 A T 10: 128,020,269 probably null Het
Rnf17 TG T 14: 56,424,542 probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Slc7a5 A T 8: 121,885,952 I371N probably damaging Het
Taf1c G T 8: 119,603,050 D117E probably damaging Het
Tekt5 T C 16: 10,395,064 D119G probably benign Het
Top3b T C 16: 16,888,003 I508T probably damaging Het
Uba6 A G 5: 86,131,337 I673T probably benign Het
Vmn2r17 G T 5: 109,428,521 M419I probably benign Het
Zfr C T 15: 12,152,968 Q562* probably null Het
Zfyve16 A T 13: 92,513,820 D885E probably benign Het
Other mutations in Olfr1197
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Olfr1197 APN 2 88729065 missense probably damaging 1.00
IGL01515:Olfr1197 APN 2 88729008 missense probably benign
IGL01822:Olfr1197 APN 2 88728792 missense probably benign 0.03
IGL02060:Olfr1197 APN 2 88729563 missense probably damaging 0.98
IGL02466:Olfr1197 APN 2 88729395 missense probably damaging 1.00
IGL02698:Olfr1197 APN 2 88729471 missense probably damaging 1.00
R0336:Olfr1197 UTSW 2 88729154 missense possibly damaging 0.47
R1037:Olfr1197 UTSW 2 88729032 missense probably damaging 1.00
R1120:Olfr1197 UTSW 2 88728937 missense probably damaging 1.00
R1674:Olfr1197 UTSW 2 88729257 missense probably damaging 0.99
R1801:Olfr1197 UTSW 2 88729264 missense probably damaging 1.00
R1860:Olfr1197 UTSW 2 88729330 missense probably damaging 1.00
R1861:Olfr1197 UTSW 2 88729330 missense probably damaging 1.00
R2049:Olfr1197 UTSW 2 88728745 missense probably damaging 1.00
R2308:Olfr1197 UTSW 2 88729084 missense probably damaging 0.97
R2411:Olfr1197 UTSW 2 88729397 missense probably benign 0.06
R4707:Olfr1197 UTSW 2 88728712 missense possibly damaging 0.62
R5000:Olfr1197 UTSW 2 88729566 missense probably damaging 0.96
R5157:Olfr1197 UTSW 2 88729548 missense probably benign
R6000:Olfr1197 UTSW 2 88729231 missense probably damaging 1.00
R6021:Olfr1197 UTSW 2 88728950 nonsense probably null
R6389:Olfr1197 UTSW 2 88728672 missense probably benign 0.00
R6636:Olfr1197 UTSW 2 88728841 missense probably benign 0.01
R6637:Olfr1197 UTSW 2 88728841 missense probably benign 0.01
R6979:Olfr1197 UTSW 2 88729184 missense probably benign 0.03
R7618:Olfr1197 UTSW 2 88728836 nonsense probably null
X0020:Olfr1197 UTSW 2 88729381 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCATGCACTCATTATAGGAAATG -3'
(R):5'- TTCCTAATGGGCTTAGTTAATGCAC -3'

Sequencing Primer
(F):5'- TGTAGCAGAGGTCCATGA -3'
(R):5'- TGGGCTTAGTTAATGCACATAAATAC -3'
Posted On2020-09-02