Incidental Mutation 'R8382:Plxnd1'
ID 646976
Institutional Source Beutler Lab
Gene Symbol Plxnd1
Ensembl Gene ENSMUSG00000030123
Gene Name plexin D1
Synonyms 6230425C21Rik, b2b1863Clo, b2b553Clo
MMRRC Submission 067896-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8382 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 115931772-115971966 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 115949433 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 784 (H784Q)
Ref Sequence ENSEMBL: ENSMUSP00000015511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015511]
AlphaFold Q3UH93
Predicted Effect probably benign
Transcript: ENSMUST00000015511
AA Change: H784Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123
AA Change: H784Q

DomainStartEndE-ValueType
signal peptide 1 48 N/A INTRINSIC
Sema 61 531 6.52e-90 SMART
PSI 550 603 6.06e-12 SMART
PSI 703 755 1.06e-2 SMART
Blast:PSI 850 891 9e-20 BLAST
IPT 892 981 4.43e-20 SMART
IPT 982 1068 6.61e-19 SMART
IPT 1070 1149 6.13e-14 SMART
transmembrane domain 1271 1293 N/A INTRINSIC
Pfam:Plexin_cytopl 1345 1888 5e-238 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131590
SMART Domains Protein: ENSMUSP00000115650
Gene: ENSMUSG00000030123

DomainStartEndE-ValueType
Blast:PSI 2 34 1e-13 BLAST
IPT 35 124 4.43e-20 SMART
Blast:IPT 125 177 3e-30 BLAST
Pfam:TIG 180 233 4.6e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.6%
Validation Efficiency 94% (33/35)
MGI Phenotype PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,537,645 (GRCm39) R689G probably benign Het
Anapc4 T A 5: 53,016,277 (GRCm39) probably null Het
Atg9a G A 1: 75,162,342 (GRCm39) Q523* probably null Het
Cacna1i G A 15: 80,261,017 (GRCm39) V1342M probably damaging Het
Cblif A T 19: 11,727,090 (GRCm39) T100S probably benign Het
Ccdc87 A G 19: 4,890,018 (GRCm39) D170G possibly damaging Het
Cpsf1 A G 15: 76,485,151 (GRCm39) V541A probably benign Het
Depdc5 C T 5: 33,085,242 (GRCm39) T687M probably benign Het
Ear6 T C 14: 52,091,570 (GRCm39) I39T probably damaging Het
Fcgbp C T 7: 27,816,762 (GRCm39) A2408V probably benign Het
Frmd4b G A 6: 97,282,209 (GRCm39) T539I probably benign Het
Gm19410 T A 8: 36,276,302 (GRCm39) V1653D probably damaging Het
Jade1 A G 3: 41,519,369 (GRCm39) probably null Het
Kncn A G 4: 115,743,947 (GRCm39) N75S probably benign Het
Lig4 C T 8: 10,022,346 (GRCm39) G478D probably damaging Het
Med24 G A 11: 98,608,537 (GRCm39) T205I unknown Het
Meiob A G 17: 25,046,913 (GRCm39) E179G possibly damaging Het
Nalf1 T C 8: 9,257,972 (GRCm39) E392G probably benign Het
Or10d5 A G 9: 39,861,455 (GRCm39) V204A probably benign Het
Or4a27 A T 2: 88,559,857 (GRCm39) F29I probably damaging Het
Or8b44 A T 9: 38,410,588 (GRCm39) I208F probably damaging Het
Pcdh15 T C 10: 74,479,227 (GRCm39) V708A probably benign Het
Pclo T A 5: 14,727,080 (GRCm39) D1979E unknown Het
Prim1 A T 10: 127,856,138 (GRCm39) probably null Het
Rnf17 TG T 14: 56,661,999 (GRCm39) 132 probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,124 (GRCm39) probably benign Het
Slc7a5 A T 8: 122,612,691 (GRCm39) I371N probably damaging Het
Sp140l2 G A 1: 85,224,671 (GRCm39) S288L possibly damaging Het
Spata31e3 T C 13: 50,401,474 (GRCm39) K284R possibly damaging Het
Taf1c G T 8: 120,329,789 (GRCm39) D117E probably damaging Het
Tekt5 T C 16: 10,212,928 (GRCm39) D119G probably benign Het
Top3b T C 16: 16,705,867 (GRCm39) I508T probably damaging Het
Uba6 A G 5: 86,279,196 (GRCm39) I673T probably benign Het
Vmn2r17 G T 5: 109,576,387 (GRCm39) M419I probably benign Het
Zfr C T 15: 12,153,054 (GRCm39) Q562* probably null Het
Zfyve16 A T 13: 92,650,328 (GRCm39) D885E probably benign Het
Other mutations in Plxnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Plxnd1 APN 6 115,944,933 (GRCm39) missense possibly damaging 0.51
IGL01099:Plxnd1 APN 6 115,946,906 (GRCm39) missense probably benign
IGL01323:Plxnd1 APN 6 115,943,760 (GRCm39) missense possibly damaging 0.81
IGL01382:Plxnd1 APN 6 115,937,488 (GRCm39) missense probably damaging 1.00
IGL01786:Plxnd1 APN 6 115,936,896 (GRCm39) missense probably damaging 1.00
IGL02244:Plxnd1 APN 6 115,955,218 (GRCm39) missense probably benign 0.39
IGL02272:Plxnd1 APN 6 115,970,589 (GRCm39) missense probably damaging 1.00
IGL02293:Plxnd1 APN 6 115,940,874 (GRCm39) missense probably damaging 1.00
IGL02465:Plxnd1 APN 6 115,932,703 (GRCm39) makesense probably null
IGL02873:Plxnd1 APN 6 115,936,937 (GRCm39) missense probably damaging 1.00
IGL03209:Plxnd1 APN 6 115,939,318 (GRCm39) missense probably damaging 1.00
Hiss UTSW 6 115,946,890 (GRCm39) missense possibly damaging 0.94
murmer UTSW 6 115,945,754 (GRCm39) missense probably benign 0.00
mutter UTSW 6 115,945,005 (GRCm39) missense probably benign 0.27
rattle UTSW 6 115,936,755 (GRCm39) missense probably damaging 0.96
R0238:Plxnd1 UTSW 6 115,945,754 (GRCm39) missense probably benign 0.00
R0238:Plxnd1 UTSW 6 115,945,754 (GRCm39) missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115,945,754 (GRCm39) missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115,945,754 (GRCm39) missense probably benign 0.00
R0357:Plxnd1 UTSW 6 115,946,421 (GRCm39) missense probably benign 0.00
R0646:Plxnd1 UTSW 6 115,935,660 (GRCm39) splice site probably benign
R0648:Plxnd1 UTSW 6 115,970,962 (GRCm39) missense possibly damaging 0.86
R0718:Plxnd1 UTSW 6 115,943,599 (GRCm39) missense possibly damaging 0.68
R1116:Plxnd1 UTSW 6 115,943,966 (GRCm39) splice site probably null
R1292:Plxnd1 UTSW 6 115,939,644 (GRCm39) unclassified probably benign
R1715:Plxnd1 UTSW 6 115,945,642 (GRCm39) missense probably benign 0.02
R1760:Plxnd1 UTSW 6 115,944,740 (GRCm39) missense possibly damaging 0.95
R1799:Plxnd1 UTSW 6 115,971,018 (GRCm39) missense probably damaging 1.00
R1817:Plxnd1 UTSW 6 115,957,562 (GRCm39) missense possibly damaging 0.83
R1848:Plxnd1 UTSW 6 115,943,507 (GRCm39) missense probably damaging 1.00
R1851:Plxnd1 UTSW 6 115,940,875 (GRCm39) missense probably damaging 1.00
R1864:Plxnd1 UTSW 6 115,946,402 (GRCm39) splice site probably null
R1865:Plxnd1 UTSW 6 115,946,402 (GRCm39) splice site probably null
R1875:Plxnd1 UTSW 6 115,955,045 (GRCm39) splice site probably null
R1899:Plxnd1 UTSW 6 115,946,324 (GRCm39) missense probably benign
R1913:Plxnd1 UTSW 6 115,954,978 (GRCm39) missense possibly damaging 0.50
R1970:Plxnd1 UTSW 6 115,939,478 (GRCm39) missense probably damaging 1.00
R2007:Plxnd1 UTSW 6 115,944,216 (GRCm39) missense probably damaging 1.00
R2134:Plxnd1 UTSW 6 115,934,509 (GRCm39) missense probably damaging 1.00
R2202:Plxnd1 UTSW 6 115,939,725 (GRCm39) missense probably benign 0.45
R2230:Plxnd1 UTSW 6 115,941,105 (GRCm39) missense probably damaging 1.00
R2267:Plxnd1 UTSW 6 115,939,704 (GRCm39) missense probably benign 0.29
R2427:Plxnd1 UTSW 6 115,944,709 (GRCm39) critical splice donor site probably null
R4108:Plxnd1 UTSW 6 115,936,276 (GRCm39) missense probably damaging 1.00
R4233:Plxnd1 UTSW 6 115,942,914 (GRCm39) missense probably benign 0.30
R4280:Plxnd1 UTSW 6 115,933,056 (GRCm39) splice site probably null
R4280:Plxnd1 UTSW 6 115,933,055 (GRCm39) splice site probably benign
R4346:Plxnd1 UTSW 6 115,954,941 (GRCm39) missense probably benign 0.16
R4439:Plxnd1 UTSW 6 115,970,937 (GRCm39) missense probably damaging 0.99
R4572:Plxnd1 UTSW 6 115,932,717 (GRCm39) missense probably damaging 1.00
R4576:Plxnd1 UTSW 6 115,945,005 (GRCm39) missense probably benign 0.27
R4599:Plxnd1 UTSW 6 115,971,237 (GRCm39) missense probably damaging 1.00
R4614:Plxnd1 UTSW 6 115,949,486 (GRCm39) missense possibly damaging 0.83
R4700:Plxnd1 UTSW 6 115,935,576 (GRCm39) missense probably damaging 1.00
R4705:Plxnd1 UTSW 6 115,935,581 (GRCm39) missense probably damaging 1.00
R4806:Plxnd1 UTSW 6 115,937,816 (GRCm39) missense probably damaging 1.00
R4944:Plxnd1 UTSW 6 115,932,726 (GRCm39) missense probably damaging 1.00
R4977:Plxnd1 UTSW 6 115,971,337 (GRCm39) missense probably damaging 1.00
R5069:Plxnd1 UTSW 6 115,942,862 (GRCm39) missense probably damaging 0.98
R5155:Plxnd1 UTSW 6 115,935,949 (GRCm39) critical splice donor site probably null
R5460:Plxnd1 UTSW 6 115,934,609 (GRCm39) missense probably damaging 1.00
R5729:Plxnd1 UTSW 6 115,942,838 (GRCm39) missense probably damaging 1.00
R5909:Plxnd1 UTSW 6 115,945,649 (GRCm39) missense probably benign 0.00
R5992:Plxnd1 UTSW 6 115,944,748 (GRCm39) critical splice acceptor site probably null
R6129:Plxnd1 UTSW 6 115,955,135 (GRCm39) missense probably damaging 1.00
R6254:Plxnd1 UTSW 6 115,954,921 (GRCm39) missense probably benign 0.01
R6273:Plxnd1 UTSW 6 115,955,453 (GRCm39) missense probably damaging 1.00
R6310:Plxnd1 UTSW 6 115,953,697 (GRCm39) missense possibly damaging 0.94
R6732:Plxnd1 UTSW 6 115,946,890 (GRCm39) missense possibly damaging 0.94
R6857:Plxnd1 UTSW 6 115,970,724 (GRCm39) missense probably benign 0.05
R7243:Plxnd1 UTSW 6 115,949,468 (GRCm39) missense probably benign 0.00
R7282:Plxnd1 UTSW 6 115,937,798 (GRCm39) missense probably damaging 1.00
R7632:Plxnd1 UTSW 6 115,953,600 (GRCm39) missense probably benign
R7699:Plxnd1 UTSW 6 115,936,755 (GRCm39) missense probably damaging 0.96
R7915:Plxnd1 UTSW 6 115,943,879 (GRCm39) missense probably benign 0.00
R8090:Plxnd1 UTSW 6 115,933,578 (GRCm39) missense probably damaging 1.00
R8507:Plxnd1 UTSW 6 115,943,866 (GRCm39) missense probably damaging 0.97
R8539:Plxnd1 UTSW 6 115,939,768 (GRCm39) missense possibly damaging 0.94
R8548:Plxnd1 UTSW 6 115,934,558 (GRCm39) missense probably damaging 1.00
R8963:Plxnd1 UTSW 6 115,949,506 (GRCm39) nonsense probably null
R9119:Plxnd1 UTSW 6 115,932,832 (GRCm39) splice site probably benign
R9177:Plxnd1 UTSW 6 115,943,469 (GRCm39) missense probably benign 0.00
R9182:Plxnd1 UTSW 6 115,970,746 (GRCm39) missense probably damaging 0.98
R9185:Plxnd1 UTSW 6 115,934,526 (GRCm39) missense probably damaging 1.00
R9226:Plxnd1 UTSW 6 115,934,524 (GRCm39) missense probably damaging 1.00
R9433:Plxnd1 UTSW 6 115,945,754 (GRCm39) missense probably benign 0.00
R9449:Plxnd1 UTSW 6 115,932,730 (GRCm39) missense probably damaging 1.00
R9451:Plxnd1 UTSW 6 115,940,277 (GRCm39) missense possibly damaging 0.72
R9599:Plxnd1 UTSW 6 115,940,274 (GRCm39) missense possibly damaging 0.78
R9627:Plxnd1 UTSW 6 115,940,274 (GRCm39) missense possibly damaging 0.78
R9644:Plxnd1 UTSW 6 115,940,274 (GRCm39) missense possibly damaging 0.78
R9672:Plxnd1 UTSW 6 115,940,274 (GRCm39) missense possibly damaging 0.78
X0024:Plxnd1 UTSW 6 115,940,271 (GRCm39) missense probably benign 0.02
X0026:Plxnd1 UTSW 6 115,943,745 (GRCm39) missense possibly damaging 0.88
Z1088:Plxnd1 UTSW 6 115,944,471 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGAGCCACTATGTCAGGGAG -3'
(R):5'- GTCTCCTTATCTAGAAAGTGGGG -3'

Sequencing Primer
(F):5'- ACTATGTCAGGGAGCCTCCAG -3'
(R):5'- TATGGAGACTGTTGGCACCC -3'
Posted On 2020-09-02